RchiOBHm_Chr1g0324901

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000857
Physical Location & Seq
Forward (+)
12656424 .. 12656897
474 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55470

Sequence Viewer

Length: 210 bp
ATGCATTTTGAAATCCACAATCAGAAATTACGCATGCATATATATTTGGCTGATTGTAAAGTTGCTCAAATGACATGGCATGTTAGCATTCTTCTAGTAGTTTGTCCCCTAAGTAGTGGTAAAATTAACAATAGCATTCTGCTGCCTATCAATGTTACTGCAGATCACTATCTTCTCTTTGATTTTCCAACACCAGGAATATTATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.86

Weight (kDa)

6.95

Isoelectric Point (pI)

58.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 1 cut(s) 11
AjnI CCWGG 1 cut(s) 193
ApeKI GCWGC 1 cut(s) 142
BbvI GCAGC 1 cut(s) 129
BciT130I CCWGG 1 cut(s) 195
BfaI CTAG 1 cut(s) 95
BfmI CTRYAG 1 cut(s) 159
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 195
BsaBI GATNNNNATC 1 cut(s) 168
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse8I GATNNNNATC 1 cut(s) 168
BseBI CCWGG 1 cut(s) 195
BseJI GATNNNNATC 1 cut(s) 168
BseLI CCNNNNNNNGG 1 cut(s) 194
BseXI GCAGC 1 cut(s) 129
BslFI GGGAC 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 90
BsmI GAATGC 2 cut(s) 87, 135
Bsp143I GATC 1 cut(s) 163
BspHI TCATGA 1 cut(s) 206
BspMAI CTGCAG 1 cut(s) 163
BssMI GATC 1 cut(s) 163
Bst2UI CCWGG 1 cut(s) 195
BstC8I GCNNGC 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 110
BstKTI GATC 1 cut(s) 166
BstMBI GATC 1 cut(s) 163
BstNI CCWGG 1 cut(s) 195
BstNSI RCATGY 2 cut(s) 37, 83
BstSCI CCNGG 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 159
BstV1I GCAGC 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 35
CciI TCATGA 1 cut(s) 206
CviAII CATG 4 cut(s) 34, 75, 80, 207
CviJI RGCY 1 cut(s) 50
CviKI_1 RGCY 1 cut(s) 50
DdeI CTNAG 1 cut(s) 110
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
EcoRII CCWGG 1 cut(s) 193
EcoT22I ATGCAT 2 cut(s) 6, 39
FaeI CATG 4 cut(s) 37, 78, 83, 210
FaiI YATR 7 cut(s) 35, 39, 41, 43, 76, 81, 208
FaqI GGGAC 1 cut(s) 90
FatI CATG 4 cut(s) 33, 74, 79, 206
Fnu4HI GCNGC 1 cut(s) 143
Fsp4HI GCNGC 1 cut(s) 143
FspBI CTAG 1 cut(s) 95
GluI GCNGC 1 cut(s) 143
Hin1II CATG 4 cut(s) 37, 78, 83, 210
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 207
HpyCH4V TGCA 3 cut(s) 4, 37, 161
HpyF3I CTNAG 1 cut(s) 110
Hsp92II CATG 4 cut(s) 37, 78, 83, 210
Kzo9I GATC 1 cut(s) 163
LpnPI CCDG 1 cut(s) 180
Lsp1109I GCAGC 1 cut(s) 129
MaeI CTAG 1 cut(s) 95
MaeIII GTNAC 1 cut(s) 154
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 2 cut(s) 83, 164
MluCI AATT 2 cut(s) 26, 123
Mph1103I ATGCAT 2 cut(s) 6, 39
MseI TTAA 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 195
Mva1269I GAATGC 2 cut(s) 87, 135
MvaI CCWGG 1 cut(s) 195
NdeII GATC 1 cut(s) 163
NlaIII CATG 4 cut(s) 37, 78, 83, 210
NsiI ATGCAT 2 cut(s) 6, 39
NspI RCATGY 2 cut(s) 37, 83
PaeI GCATGC 1 cut(s) 37
PagI TCATGA 1 cut(s) 206
PctI GAATGC 2 cut(s) 87, 135
PkrI GCNGC 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PstI CTGCAG 1 cut(s) 163
SaqAI TTAA 1 cut(s) 126
SatI GCNGC 1 cut(s) 143
Sau3AI GATC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 195
SfcI CTRYAG 1 cut(s) 159
SgeI CNNG 5 cut(s) 46, 87, 92, 107, 206
SphI GCATGC 1 cut(s) 37
Sse9I AATT 2 cut(s) 26, 123
SspI AATATT 1 cut(s) 201
SspMI CTAG 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 193
TasI AATT 2 cut(s) 26, 123
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TseI GCWGC 1 cut(s) 142
XceI RCATGY 2 cut(s) 37, 83
XspI CTAG 1 cut(s) 95
Zsp2I ATGCAT 2 cut(s) 6, 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.