Rroxscaffold_3G00260930

Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
55260668 .. 55261247
580 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00260930.1

Sequence Viewer

Length: 228 bp
ATGGACCTTGAAAGGCTTAAAGATCTTGTTCATGTTGTTGAAAAAGAAAGGCTTGTTTTAGAAAGCTTAGCTGTAGAAAGAGAGTATGAAGAAGGTAAATATGCAATTGTCACAGATAGATGGCAAAAGTTCCGTGACGTGTATCTTGACAAGGAAATATTAGACTTCCTTGCCAAGTATGTGGACGAGTTTCTGGTACATGGTATCGATGTGGAAGGGAAAAAGTAA

Protein Analysis

75

Amino Acids

9.01

Weight (kDa)

4.87

Isoelectric Point (pI)

17.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 198
AflIII ACRYGT 1 cut(s) 138
AgsI TTSAA 2 cut(s) 11, 41
AjiI CACGTC 1 cut(s) 139
AluBI AGCT 2 cut(s) 66, 71
AluI AGCT 2 cut(s) 66, 71
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BccI CCATC 1 cut(s) 114
BfmI CTRYAG 1 cut(s) 72
BglII AGATCT 1 cut(s) 22
BlpI GCTNAGC 1 cut(s) 67
Bme18I GGWCC 1 cut(s) 4
BmgBI CACGTC 1 cut(s) 139
BmgT120I GGNCC 1 cut(s) 4
Bpu1102I GCTNAGC 1 cut(s) 67
Bsa29I ATCGAT 1 cut(s) 207
BseCI ATCGAT 1 cut(s) 207
BshVI ATCGAT 1 cut(s) 207
Bsp143I GATC 1 cut(s) 22
Bsp1720I GCTNAGC 1 cut(s) 67
BspDI ATCGAT 1 cut(s) 207
BssMI GATC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 67
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstSFI CTRYAG 1 cut(s) 72
BstX2I RGATCY 1 cut(s) 22
BstXI CCANNNNNNTGG 1 cut(s) 181
BstYI RGATCY 1 cut(s) 22
Bsu15I ATCGAT 1 cut(s) 207
BsuTUI ATCGAT 1 cut(s) 207
BtrI CACGTC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 4
ClaI ATCGAT 1 cut(s) 207
Csp6I GTAC 1 cut(s) 197
CviAII CATG 2 cut(s) 32, 200
CviJI RGCY 4 cut(s) 16, 52, 66, 71
CviKI_1 RGCY 4 cut(s) 16, 52, 66, 71
CviQI GTAC 1 cut(s) 197
DdeI CTNAG 1 cut(s) 67
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco47I GGWCC 1 cut(s) 4
FaeI CATG 2 cut(s) 35, 203
FaiI YATR 5 cut(s) 33, 87, 102, 180, 201
FalI AAGNNNNNCTT 2 cut(s) 36, 68
FatI CATG 2 cut(s) 31, 199
Hin1II CATG 2 cut(s) 35, 203
HindIII AAGCTT 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 184
Hpy188III TCNNGA 1 cut(s) 146
Hpy8I GTNNAC 1 cut(s) 184
HpyAV CCTTC 2 cut(s) 86, 209
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 67
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 2 cut(s) 35, 203
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 1 cut(s) 179
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 2 cut(s) 109, 134
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MboII GAAGA 1 cut(s) 101
MfeI CAATTG 1 cut(s) 105
MflI RGATCY 1 cut(s) 22
MluCI AATT 1 cut(s) 105
MseI TTAA 1 cut(s) 18
MunI CAATTG 1 cut(s) 105
NdeII GATC 1 cut(s) 22
NlaIII CATG 2 cut(s) 35, 203
NmuCI GTSAC 2 cut(s) 109, 134
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 1 cut(s) 22
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 1 cut(s) 22
Sau96I GGNCC 1 cut(s) 4
SetI ASST 5 cut(s) 9, 68, 73, 97, 141
SfcI CTRYAG 1 cut(s) 72
SinI GGWCC 1 cut(s) 4
Sse9I AATT 1 cut(s) 105
SspI AATATT 1 cut(s) 159
TaiI ACGT 1 cut(s) 141
TaqI TCGA 1 cut(s) 207
TasI AATT 1 cut(s) 105
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TseFI GTSAC 2 cut(s) 109, 134
Tsp45I GTSAC 2 cut(s) 109, 134
TspDTI ATGAA 2 cut(s) 20, 102
TspGWI ACGGA 1 cut(s) 122
VpaK11BI GGWCC 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.