RchiOBHm_Chr1g0350151

Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
43261245 .. 43266298
5054 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57603

Sequence Viewer

Length: 513 bp
ATGTGTAAGGTTAGTGTCGAGAAGCCCTCAGAAGCAGAGGGCCACAATTCCTTTGAGAAAGCCCTCACAATTCCTTTGAGAAGCCCTCAGAAGCAAAGGGCCACAATTCCTTTCAAACCACTGAGCTTCTCTCTATTTTGCTTCAATACCAGAAATCTACTTTCTCTTGGAGGTGGGATCAATTCAGATAATTCTTTGCAATACATAGAAGACGGGGCTAGCCACGTCATTGTCACTTCTTATGTATTTAATAATGGGCAAAACCTTGAAAGGCTTAAAGATCTTGTTCGTGTTGTTGGAAAAGAAAGGCTTGTTTTAGACCTTAGCTGTAGAAAGAGGGAAGGTAAATATGCAATTGTCACAGATAGATGGCAAAAGTTCAGTGACGTGTATCTTGACAAGGAAATATTAGACTTCCTTATGCAGACGAGTTTCTGGTACATGGTGTCGATGTGGAAGGGAAAAAATCACTATCTTCTCTTTGATTTTCCAACACCAGGAATATTATCATGA

Protein Analysis

170

Amino Acids

19.55

Weight (kDa)

8.96

Isoelectric Point (pI)

36.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
His_biosynth PF00977 54 - 132 3.3e-06 Histidine biosynthesis protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 185
AfaI GTAC 1 cut(s) 440
AfiI CCNNNNNNNGG 1 cut(s) 497
AflIII ACRYGT 1 cut(s) 387
AgsI TTSAA 3 cut(s) 115, 145, 269
AjiI CACGTC 2 cut(s) 226, 388
AjnI CCWGG 1 cut(s) 496
AluBI AGCT 2 cut(s) 126, 327
AluI AGCT 2 cut(s) 126, 327
AlwI GGATC 1 cut(s) 185
AoxI GGCC 2 cut(s) 40, 99
AspS9I GGNCC 2 cut(s) 40, 99
AsuNHI GCTAGC 1 cut(s) 218
BbsI GAAGAC 1 cut(s) 216
BccI CCATC 1 cut(s) 363
BciT130I CCWGG 1 cut(s) 498
BfaI CTAG 1 cut(s) 219
BfmI CTRYAG 1 cut(s) 328
BglII AGATCT 1 cut(s) 280
Bme1390I CCNGG 1 cut(s) 498
BmgBI CACGTC 2 cut(s) 226, 388
BmgT120I GGNCC 2 cut(s) 40, 99
BmrFI CCNGG 1 cut(s) 498
BmtI GCTAGC 1 cut(s) 222
BpiI GAAGAC 1 cut(s) 216
BplI GAGNNNNNCTC 6 cut(s) 11, 43, 70, 102, 115, 147
Bpu10I CCTNAGC 1 cut(s) 323
Bsc4I CCNNNNNNNGG 1 cut(s) 497
BseBI CCWGG 1 cut(s) 498
BseLI CCNNNNNNNGG 1 cut(s) 497
BseMII CTCAG 3 cut(s) 42, 101, 113
BshFI GGCC 2 cut(s) 42, 101
BslI CCNNNNNNNGG 1 cut(s) 497
BsnI GGCC 2 cut(s) 42, 101
Bsp143I GATC 2 cut(s) 177, 280
BspANI GGCC 2 cut(s) 42, 101
BspCNI CTCAG 3 cut(s) 41, 100, 114
BspHI TCATGA 1 cut(s) 509
BspOI GCTAGC 1 cut(s) 222
BspPI GGATC 1 cut(s) 185
BssMI GATC 2 cut(s) 177, 280
Bst2UI CCWGG 1 cut(s) 498
BstC8I GCNNGC 1 cut(s) 220
BstDEI CTNAG 4 cut(s) 28, 87, 122, 323
BstKTI GATC 2 cut(s) 180, 283
BstMBI GATC 2 cut(s) 177, 280
BstNI CCWGG 1 cut(s) 498
BstSCI CCNGG 1 cut(s) 496
BstSFI CTRYAG 1 cut(s) 328
BstV2I GAAGAC 1 cut(s) 216
BstX2I RGATCY 1 cut(s) 280
BstYI RGATCY 1 cut(s) 280
BsuRI GGCC 2 cut(s) 42, 101
BtrI CACGTC 2 cut(s) 226, 388
BtsIMutI CAGTG 2 cut(s) 119, 388
Cac8I GCNNGC 1 cut(s) 220
CciI TCATGA 1 cut(s) 509
Cfr13I GGNCC 2 cut(s) 40, 99
Csp6I GTAC 1 cut(s) 439
CviAII CATG 2 cut(s) 442, 510
CviQI GTAC 1 cut(s) 439
DdeI CTNAG 4 cut(s) 28, 87, 122, 323
DpnI GATC 2 cut(s) 179, 282
DpnII GATC 2 cut(s) 177, 280
EcoRII CCWGG 1 cut(s) 496
FaeI CATG 2 cut(s) 445, 513
FaiI YATR 6 cut(s) 206, 243, 351, 422, 443, 511
FalI AAGNNNNNCTT 2 cut(s) 294, 326
FatI CATG 2 cut(s) 441, 509
FspBI CTAG 1 cut(s) 219
HaeIII GGCC 2 cut(s) 42, 101
Hin1II CATG 2 cut(s) 445, 513
Hpy188I TCNGA 3 cut(s) 31, 90, 187
Hpy188III TCNNGA 3 cut(s) 19, 395, 510
HpyAV CCTTC 2 cut(s) 335, 451
HpyCH4IV ACGT 2 cut(s) 225, 387
HpyCH4V TGCA 3 cut(s) 199, 353, 424
HpyF3I CTNAG 4 cut(s) 28, 87, 122, 323
HpySE526I ACGT 2 cut(s) 225, 387
Hsp92II CATG 2 cut(s) 445, 513
Kzo9I GATC 2 cut(s) 177, 280
LpnPI CCDG 3 cut(s) 163, 421, 483
MaeI CTAG 1 cut(s) 219
MaeII ACGT 2 cut(s) 225, 387
MaeIII GTNAC 3 cut(s) 232, 358, 383
MalI GATC 2 cut(s) 179, 282
MboI GATC 2 cut(s) 177, 280
MboII GAAGA 2 cut(s) 221, 467
MfeI CAATTG 1 cut(s) 354
MflI RGATCY 1 cut(s) 280
MluCI AATT 6 cut(s) 46, 69, 105, 181, 190, 354
MmeI TCCRAC 1 cut(s) 277
MnlI CCTC 6 cut(s) 31, 37, 74, 96, 164, 330
MseI TTAA 2 cut(s) 249, 276
MspR9I CCNGG 1 cut(s) 498
MunI CAATTG 1 cut(s) 354
MvaI CCWGG 1 cut(s) 498
NdeII GATC 2 cut(s) 177, 280
NheI GCTAGC 1 cut(s) 218
NlaIII CATG 2 cut(s) 445, 513
NmuCI GTSAC 3 cut(s) 232, 358, 383
PagI TCATGA 1 cut(s) 509
Psp6I CCWGG 1 cut(s) 496
PspGI CCWGG 1 cut(s) 496
PspPI GGNCC 2 cut(s) 40, 99
PsuI RGATCY 1 cut(s) 280
RsaI GTAC 1 cut(s) 440
RsaNI GTAC 1 cut(s) 439
SaqAI TTAA 2 cut(s) 249, 276
Sau3AI GATC 2 cut(s) 177, 280
Sau96I GGNCC 2 cut(s) 40, 99
ScrFI CCNGG 1 cut(s) 498
SetI ASST 9 cut(s) 12, 128, 175, 228, 267, 324, 329, 346, 390
SfcI CTRYAG 1 cut(s) 328
Sse9I AATT 6 cut(s) 46, 69, 105, 181, 190, 354
SspI AATATT 2 cut(s) 408, 504
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 496
TaiI ACGT 2 cut(s) 228, 390
TaqI TCGA 2 cut(s) 18, 449
TasI AATT 6 cut(s) 46, 69, 105, 181, 190, 354
Tru1I TTAA 2 cut(s) 249, 276
Tru9I TTAA 2 cut(s) 249, 276
TscAI CASTG 2 cut(s) 126, 388
TseFI GTSAC 3 cut(s) 232, 358, 383
Tsp45I GTSAC 3 cut(s) 232, 358, 383
TspRI CASTG 2 cut(s) 126, 388
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.