Rroxscaffold_5G00355640

Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
34432932 .. 34436656
3725 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00355640.1

Sequence Viewer

Length: 171 bp
ATGGACCTTGAAAGGCTTAAAGATCTTGTTCATGTTGTTGGAAAAGAAAGGCTTGTTTTAGACCTTAGCTGTAGAAAGAGGTGGGCGGTAAAGACGTGCAAATCATATAGCCAAGCTCAAATTGACGAGGTGCGCATTGAAGTGGCTGATTATATACAGAGTTGGGTGTAG

Protein Analysis

56

Amino Acids

6.62

Weight (kDa)

7.79

Isoelectric Point (pI)

40.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 134
AciI CCGC 1 cut(s) 86
AgsI TTSAA 2 cut(s) 11, 140
AjiI CACGTC 1 cut(s) 96
AluBI AGCT 2 cut(s) 69, 116
AluI AGCT 2 cut(s) 69, 116
AspLEI GCGC 1 cut(s) 135
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BfmI CTRYAG 1 cut(s) 70
BglII AGATCT 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 4
BmgBI CACGTC 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 4
Bpu10I CCTNAGC 1 cut(s) 65
Bsp143I GATC 1 cut(s) 22
BspACI CCGC 1 cut(s) 86
BssMI GATC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 65
BstHHI GCGC 1 cut(s) 135
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstSFI CTRYAG 1 cut(s) 70
BstX2I RGATCY 1 cut(s) 22
BstYI RGATCY 1 cut(s) 22
BtrI CACGTC 1 cut(s) 96
CfoI GCGC 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 1 cut(s) 32
CviJI RGCY 6 cut(s) 16, 52, 69, 111, 116, 146
CviKI_1 RGCY 6 cut(s) 16, 52, 69, 111, 116, 146
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco47I GGWCC 1 cut(s) 4
FaeI CATG 1 cut(s) 35
FaiI YATR 5 cut(s) 33, 106, 108, 153, 155
FalI AAGNNNNNCTT 2 cut(s) 36, 68
FatI CATG 1 cut(s) 31
FspAI RTGCGCAY 1 cut(s) 134
FspI TGCGCA 1 cut(s) 134
GlaI GCGC 1 cut(s) 134
HhaI GCGC 1 cut(s) 135
Hin1II CATG 1 cut(s) 35
Hin6I GCGC 1 cut(s) 133
HinP1I GCGC 1 cut(s) 133
HpyCH4IV ACGT 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 99
HpyF3I CTNAG 1 cut(s) 65
HpySE526I ACGT 1 cut(s) 95
Hsp92II CATG 1 cut(s) 35
HspAI GCGC 1 cut(s) 133
Kzo9I GATC 1 cut(s) 22
MaeII ACGT 1 cut(s) 95
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MflI RGATCY 1 cut(s) 22
MluCI AATT 1 cut(s) 120
MmeI TCCRAC 1 cut(s) 19
MnlI CCTC 2 cut(s) 72, 121
MseI TTAA 1 cut(s) 18
MslI CAYNNNNRTG 1 cut(s) 140
NdeII GATC 1 cut(s) 22
NlaIII CATG 1 cut(s) 35
NsbI TGCGCA 1 cut(s) 134
PspPI GGNCC 1 cut(s) 4
PsuI RGATCY 1 cut(s) 22
RseI CAYNNNNRTG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 1 cut(s) 22
Sau96I GGNCC 1 cut(s) 4
SetI ASST 7 cut(s) 9, 66, 71, 83, 98, 118, 132
SfcI CTRYAG 1 cut(s) 70
SgeI CNNG 7 cut(s) 20, 38, 44, 65, 108, 125, 139
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 140
Sse9I AATT 1 cut(s) 120
SsiI CCGC 1 cut(s) 86
TaiI ACGT 1 cut(s) 98
TasI AATT 1 cut(s) 120
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 20
VpaK11BI GGWCC 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.