RLG00000014193

Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Reverse (-)
49062566 .. 49063430
865 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000014193

Sequence Viewer

Length: 372 bp
ATGATTGATGATATGTTTAAACTTACATATTTTCCTCTGCTGAACTTGCTACGAGGACTGGTAGGAGGTGGGATCAATTCAGATAATTCTTTGCAATACATAGAAGAAGGGGCTAGCCACGTCATTGTCACTTCTTATGTATTTAATAATGGGCAAAACCTTGAAAGGCTTAAAGATCTTGTTCGTGTTGTTGGAAAAGAAAGGCTTGTTTTAGACCTTAGCTGTAGAAAGAGGGAAGGTAAATATGCAATTGTCACAGATAGATGGCAAAAGTCCAGTGACGTGTATCTTGACAAGGAAATATTAGACTTCCTTGCCAAGTATGCAGACGAGTTTCTGGTACATGGTGTCGATGTGGAAGGGAAAAAGTAA

Protein Analysis

124

Amino Acids

14.06

Weight (kDa)

5.68

Isoelectric Point (pI)

24.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
His_biosynth PF00977 21 - 122 1.1e-10 Histidine biosynthesis protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AfaI GTAC 1 cut(s) 342
AflIII ACRYGT 1 cut(s) 282
AgsI TTSAA 1 cut(s) 164
AjiI CACGTC 2 cut(s) 121, 283
AluBI AGCT 1 cut(s) 222
AluI AGCT 1 cut(s) 222
AlwI GGATC 1 cut(s) 80
AsuNHI GCTAGC 1 cut(s) 113
BccI CCATC 1 cut(s) 258
BfaI CTAG 1 cut(s) 114
BfmI CTRYAG 1 cut(s) 223
BglII AGATCT 1 cut(s) 175
BmgBI CACGTC 2 cut(s) 121, 283
BmtI GCTAGC 1 cut(s) 117
Bpu10I CCTNAGC 1 cut(s) 218
Bse1I ACTGG 2 cut(s) 63, 276
BseNI ACTGG 2 cut(s) 63, 276
Bsp143I GATC 2 cut(s) 72, 175
BspOI GCTAGC 1 cut(s) 117
BspPI GGATC 1 cut(s) 80
BsrI ACTGG 2 cut(s) 63, 276
BssMI GATC 2 cut(s) 72, 175
BstC8I GCNNGC 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 218
BstKTI GATC 2 cut(s) 75, 178
BstMBI GATC 2 cut(s) 72, 175
BstMWI GCNNNNNNNGC 2 cut(s) 46, 323
BstSFI CTRYAG 1 cut(s) 223
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
BtrI CACGTC 2 cut(s) 121, 283
BtsIMutI CAGTG 1 cut(s) 283
Cac8I GCNNGC 1 cut(s) 115
Csp6I GTAC 1 cut(s) 341
CviAII CATG 1 cut(s) 344
CviJI RGCY 5 cut(s) 113, 117, 169, 205, 222
CviKI_1 RGCY 5 cut(s) 113, 117, 169, 205, 222
CviQI GTAC 1 cut(s) 341
DdeI CTNAG 1 cut(s) 218
DpnI GATC 2 cut(s) 74, 177
DpnII GATC 2 cut(s) 72, 175
DraI TTTAAA 1 cut(s) 19
FaeI CATG 1 cut(s) 347
FaiI YATR 7 cut(s) 14, 28, 101, 138, 246, 324, 345
FalI AAGNNNNNCTT 2 cut(s) 189, 221
FatI CATG 1 cut(s) 343
FspBI CTAG 1 cut(s) 114
Hin1II CATG 1 cut(s) 347
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 290
HpyAV CCTTC 3 cut(s) 101, 230, 353
HpyCH4IV ACGT 2 cut(s) 120, 282
HpyCH4V TGCA 3 cut(s) 94, 248, 326
HpyF10VI GCNNNNNNNGC 2 cut(s) 46, 323
HpyF3I CTNAG 1 cut(s) 218
HpySE526I ACGT 2 cut(s) 120, 282
Hsp92II CATG 1 cut(s) 347
Kzo9I GATC 2 cut(s) 72, 175
LpnPI CCDG 3 cut(s) 44, 289, 323
MaeI CTAG 1 cut(s) 114
MaeII ACGT 2 cut(s) 120, 282
MaeIII GTNAC 3 cut(s) 127, 253, 278
MalI GATC 2 cut(s) 74, 177
MboI GATC 2 cut(s) 72, 175
MboII GAAGA 1 cut(s) 116
MfeI CAATTG 1 cut(s) 249
MflI RGATCY 1 cut(s) 175
MluCI AATT 3 cut(s) 76, 85, 249
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 4 cut(s) 45, 47, 59, 225
MseI TTAA 3 cut(s) 18, 144, 171
MssI GTTTAAAC 1 cut(s) 19
MunI CAATTG 1 cut(s) 249
MwoI GCNNNNNNNGC 2 cut(s) 46, 323
NdeII GATC 2 cut(s) 72, 175
NheI GCTAGC 1 cut(s) 113
NlaIII CATG 1 cut(s) 347
NmuCI GTSAC 3 cut(s) 127, 253, 278
PmeI GTTTAAAC 1 cut(s) 19
PsuI RGATCY 1 cut(s) 175
RsaI GTAC 1 cut(s) 342
RsaNI GTAC 1 cut(s) 341
SaqAI TTAA 3 cut(s) 18, 144, 171
Sau3AI GATC 2 cut(s) 72, 175
SetI ASST 7 cut(s) 70, 123, 162, 219, 224, 241, 285
SfcI CTRYAG 1 cut(s) 223
Sse9I AATT 3 cut(s) 76, 85, 249
SspI AATATT 1 cut(s) 303
SspMI CTAG 1 cut(s) 114
TaiI ACGT 2 cut(s) 123, 285
TaqI TCGA 1 cut(s) 351
TasI AATT 3 cut(s) 76, 85, 249
Tru1I TTAA 3 cut(s) 18, 144, 171
Tru9I TTAA 3 cut(s) 18, 144, 171
TscAI CASTG 1 cut(s) 283
TseFI GTSAC 3 cut(s) 127, 253, 278
Tsp45I GTSAC 3 cut(s) 127, 253, 278
TspRI CASTG 1 cut(s) 283
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.