RchiOBHm_Chr2g0171141

Ribosomal_S15

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001441
Physical Location & Seq
Forward (+)
84816322 .. 84816759
438 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53858

Sequence Viewer

Length: 294 bp
ATGCTGGTTTACGGAGGTCTATTAACCTTTCCTCTTCCTGATTGTCCTGCAGTGGCACAACTCACAACTAAGATCAAGCATTTGCCTTCAGTTTTACACAAAAAGGATAAGCACTCTCTTAAGGGTCTTCAAGCAATGGTGCAGAGGCGGAAGAGATTATTGAAGTATCTTTGGCGGAGTGATTGGGTTTCTTACTGCCTTTTTCTCTCCAAACTTACAAACAAGAATACAAGAAACATTACAAGAACTAGCCCCCATCCTCATTATTGTTGTCTCTGTTTCTTGCCCGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S15

Protein Analysis

97

Amino Acids

11.28

Weight (kDa)

10.04

Isoelectric Point (pI)

59.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 18 - 72 7.8e-13 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 148, 175
AcuI CTGAAG 1 cut(s) 72
AflII CTTAAG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 131, 163
Alw26I GTCTC 1 cut(s) 278
BbsI GAAGAC 1 cut(s) 119
BccI CCATC 1 cut(s) 264
BcoDI GTCTC 1 cut(s) 278
BfaI CTAG 1 cut(s) 249
BfmI CTRYAG 1 cut(s) 48
BfrI CTTAAG 1 cut(s) 119
BpiI GAAGAC 1 cut(s) 119
Bse3DI GCAATG 1 cut(s) 141
BseGI GGATG 1 cut(s) 256
BseMI GCAATG 1 cut(s) 141
BsgI GTGCAG 1 cut(s) 161
BsmAI GTCTC 1 cut(s) 278
Bsp143I GATC 1 cut(s) 72
BspACI CCGC 2 cut(s) 148, 175
BspMAI CTGCAG 1 cut(s) 52
BspTI CTTAAG 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 141
BssMI GATC 1 cut(s) 72
Bst6I CTCTTC 2 cut(s) 39, 146
BstAFI CTTAAG 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 1 cut(s) 256
BstKTI GATC 1 cut(s) 75
BstMAI GTCTC 1 cut(s) 278
BstMBI GATC 1 cut(s) 72
BstSFI CTRYAG 1 cut(s) 48
BstV2I GAAGAC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 256
BtsI GCAGTG 1 cut(s) 57
BtsIMutI CAGTG 1 cut(s) 57
CviJI RGCY 1 cut(s) 252
CviKI_1 RGCY 1 cut(s) 252
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
Eam1104I CTCTTC 2 cut(s) 39, 146
EarI CTCTTC 2 cut(s) 39, 146
EciI GGCGGA 2 cut(s) 163, 190
Eco57I CTGAAG 1 cut(s) 72
FokI GGATG 1 cut(s) 243
FspBI CTAG 1 cut(s) 249
Hpy166II GTNNAC 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 96
HpyCH4V TGCA 2 cut(s) 50, 142
HpyF3I CTNAG 1 cut(s) 69
Kzo9I GATC 1 cut(s) 72
LpnPI CCDG 2 cut(s) 51, 60
MaeI CTAG 1 cut(s) 249
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 3 cut(s) 26, 119, 163
MnlI CCTC 4 cut(s) 8, 42, 138, 270
MseI TTAA 3 cut(s) 23, 120, 292
MspCI CTTAAG 1 cut(s) 119
NdeII GATC 1 cut(s) 72
PstI CTGCAG 1 cut(s) 52
SaqAI TTAA 3 cut(s) 23, 120, 292
Sau3AI GATC 1 cut(s) 72
SetI ASST 2 cut(s) 19, 29
SfcI CTRYAG 1 cut(s) 48
SgeI CNNG 9 cut(s) 17, 50, 59, 88, 143, 235, 243, 255, 261
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
SsiI CCGC 2 cut(s) 148, 175
SspMI CTAG 1 cut(s) 249
Tru1I TTAA 3 cut(s) 23, 120, 292
Tru9I TTAA 3 cut(s) 23, 120, 292
TscAI CASTG 1 cut(s) 57
TspGWI ACGGA 1 cut(s) 27
TspRI CASTG 1 cut(s) 57
Vha464I CTTAAG 1 cut(s) 119
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.