Rw2G051930

Ribosomal_S15

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0001441
Physical Location & Seq
Forward (+)
79739243 .. 79741201
1959 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G051930.1

Sequence Viewer

Length: 312 bp
ATGTGTAGGGAGGTAGTGGGGAAAAAGAACTGCTTTGGAAGAAAGGTTAACTGTGTTGCTTCGGCGAGAGGAGAGTTTCTGGAAGCAGAGCTGGCACAACTCACAACTAAGATCAAGCATTTGCCTTCAGTTTTACACAAAAAGGATAAGCACTCTCTTAAGGGTCTTCTAGCAATGGTGCAGAGGCGGAAGAGATTATTGAAGTATCTTTGGCGGAGTGATTGGGTTTCTTACTGCCTTTTTCTCTCCAAACTTGGCCTTCGGGACACACCAGATTACAAACAAGAATACAAGAAACATTACAAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S15

Protein Analysis

103

Amino Acids

12.17

Weight (kDa)

9.98

Isoelectric Point (pI)

29.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 27 - 88 5.1e-15 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 187, 214
AcuI CTGAAG 1 cut(s) 111
AflII CTTAAG 1 cut(s) 158
AgsI TTSAA 1 cut(s) 202
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
AoxI GGCC 1 cut(s) 256
BbsI GAAGAC 1 cut(s) 158
BfaI CTAG 2 cut(s) 170, 310
BfrI CTTAAG 1 cut(s) 158
BpiI GAAGAC 1 cut(s) 158
Bse3DI GCAATG 1 cut(s) 180
BseMI GCAATG 1 cut(s) 180
BseRI GAGGAG 1 cut(s) 84
BsgI GTGCAG 1 cut(s) 200
BshFI GGCC 1 cut(s) 258
BslFI GGGAC 1 cut(s) 278
BsmFI GGGAC 1 cut(s) 278
BsnI GGCC 1 cut(s) 258
Bsp143I GATC 1 cut(s) 111
BspACI CCGC 2 cut(s) 187, 214
BspANI GGCC 1 cut(s) 258
BspTI CTTAAG 1 cut(s) 158
BsrDI GCAATG 1 cut(s) 180
BssMI GATC 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 53
Bst6I CTCTTC 1 cut(s) 185
BstAFI CTTAAG 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 108
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstV2I GAAGAC 1 cut(s) 158
BsuRI GGCC 1 cut(s) 258
Cac8I GCNNGC 1 cut(s) 93
CviJI RGCY 2 cut(s) 91, 258
CviKI_1 RGCY 2 cut(s) 91, 258
DdeI CTNAG 1 cut(s) 108
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 185
EciI GGCGGA 2 cut(s) 202, 229
Eco57I CTGAAG 1 cut(s) 111
FalI AAGNNNNNCTT 2 cut(s) 17, 49
FaqI GGGAC 1 cut(s) 278
FspBI CTAG 2 cut(s) 170, 310
HaeIII GGCC 1 cut(s) 258
HincII GTYRAC 1 cut(s) 49
HindII GTYRAC 1 cut(s) 49
HpaI GTTAAC 1 cut(s) 49
Hpy166II GTNNAC 1 cut(s) 49
Hpy188III TCNNGA 2 cut(s) 80, 263
Hpy8I GTNNAC 1 cut(s) 49
HpyAV CCTTC 2 cut(s) 135, 269
HpyCH4III ACNGT 1 cut(s) 53
HpyCH4V TGCA 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpyF3I CTNAG 1 cut(s) 108
KspAI GTTAAC 1 cut(s) 49
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 3 cut(s) 65, 77, 285
MaeI CTAG 2 cut(s) 170, 310
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 3 cut(s) 51, 158, 202
MnlI CCTC 3 cut(s) 4, 62, 177
MseI TTAA 2 cut(s) 48, 159
MspCI CTTAAG 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 1 cut(s) 111
SaqAI TTAA 2 cut(s) 48, 159
Sau3AI GATC 1 cut(s) 111
SetI ASST 3 cut(s) 15, 48, 93
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SsiI CCGC 2 cut(s) 187, 214
SspMI CTAG 2 cut(s) 170, 310
TaaI ACNGT 1 cut(s) 53
Tru1I TTAA 2 cut(s) 48, 159
Tru9I TTAA 2 cut(s) 48, 159
Vha464I CTTAAG 1 cut(s) 158
XspI CTAG 2 cut(s) 170, 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.