Rh2DG654800

Ribosomal_S15

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
87991816 .. 87992188
373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG654800.1

Sequence Viewer

Length: 279 bp
ATGGTGATGCTGGTTTACGGAGGTCTATTAACCTTTCCTCTTCCTGATTGTCCTGCAGTGGCACAACTCACAACTAAGATCAAGCATTTGCCTTCAGTTTTACACAAAAAGGATAAGCACTCTCTTAAGGGTCTTCAAGCAATGGTGCAGAGGCGGAAGAGATTATTGAAGTATCTTTGGCGGAGTGATTGGGTTTCTTACTGCCTTTTTCTCTCCAAACTTGGCCTTCGGGACACACCAGATTACAAACAAGAATACAAGAAACATTACAAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.88

Weight (kDa)

9.97

Isoelectric Point (pI)

49.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 20 - 77 1.9e-14 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 154, 181
AcuI CTGAAG 1 cut(s) 78
AflII CTTAAG 1 cut(s) 125
AgsI TTSAA 2 cut(s) 137, 169
AoxI GGCC 1 cut(s) 223
AsuHPI GGTGA 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 125
BfaI CTAG 1 cut(s) 277
BfmI CTRYAG 1 cut(s) 54
BfrI CTTAAG 1 cut(s) 125
BpiI GAAGAC 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 147
BseMI GCAATG 1 cut(s) 147
BsgI GTGCAG 1 cut(s) 167
BshFI GGCC 1 cut(s) 225
BslFI GGGAC 1 cut(s) 245
BsmFI GGGAC 1 cut(s) 245
BsnI GGCC 1 cut(s) 225
Bsp143I GATC 1 cut(s) 78
BspACI CCGC 2 cut(s) 154, 181
BspANI GGCC 1 cut(s) 225
BspMAI CTGCAG 1 cut(s) 58
BspTI CTTAAG 1 cut(s) 125
BsrDI GCAATG 1 cut(s) 147
BssMI GATC 1 cut(s) 78
Bst6I CTCTTC 2 cut(s) 45, 152
BstAFI CTTAAG 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 75
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 54
BstV2I GAAGAC 1 cut(s) 125
BsuRI GGCC 1 cut(s) 225
BtsI GCAGTG 1 cut(s) 63
BtsIMutI CAGTG 1 cut(s) 63
CviJI RGCY 1 cut(s) 225
CviKI_1 RGCY 1 cut(s) 225
DdeI CTNAG 1 cut(s) 75
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Eam1104I CTCTTC 2 cut(s) 45, 152
EarI CTCTTC 2 cut(s) 45, 152
EciI GGCGGA 2 cut(s) 169, 196
Eco57I CTGAAG 1 cut(s) 78
FaqI GGGAC 1 cut(s) 245
FspBI CTAG 1 cut(s) 277
HaeIII GGCC 1 cut(s) 225
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 44, 230
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 102, 236
HpyCH4V TGCA 2 cut(s) 56, 148
HpyF3I CTNAG 1 cut(s) 75
Kzo9I GATC 1 cut(s) 78
LpnPI CCDG 3 cut(s) 57, 66, 252
MaeI CTAG 1 cut(s) 277
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 3 cut(s) 32, 125, 169
MnlI CCTC 3 cut(s) 14, 48, 144
MseI TTAA 2 cut(s) 29, 126
MspCI CTTAAG 1 cut(s) 125
NdeII GATC 1 cut(s) 78
PstI CTGCAG 1 cut(s) 58
SaqAI TTAA 2 cut(s) 29, 126
Sau3AI GATC 1 cut(s) 78
SetI ASST 2 cut(s) 25, 35
SfcI CTRYAG 1 cut(s) 54
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
SsiI CCGC 2 cut(s) 154, 181
SspMI CTAG 1 cut(s) 277
Tru1I TTAA 2 cut(s) 29, 126
Tru9I TTAA 2 cut(s) 29, 126
TscAI CASTG 1 cut(s) 63
TspGWI ACGGA 1 cut(s) 33
TspRI CASTG 1 cut(s) 63
Vha464I CTTAAG 1 cut(s) 125
XspI CTAG 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.