Rroxscaffold_2G00080760

Ribosomal_S15

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
3711166 .. 3721294
10129 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00080760.1

Sequence Viewer

Length: 360 bp
ATGCGCATTTGGTTTCTAAACTATTTTTTCATCTTACAAAGTCTTCAACAATTTAATTTCCGGAGGTGCAATATGAAGTGGGAGATTGGAAAACCATTCAAAATTTATCTCATCCCAGAGGAAAGGTATTTCAATAGAATGGCACAACTCACAACTAAGATCAAGCATTTGTCTTCAGTTTTACACAAAAAAGATAAGCACTCTCTTAAAGGGTTTTCAAGCAATGGTGAGAGGCGGAAGAGATTATTGAAGTATCTTTGGCGGAGTGATTGGGTTTCTTACCGCCTTGTTCTCTCCAAACTTGGCCTTCGGGACACACCAGATTACAAACAAGAATACAAGAAACATTACAAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

14.84

Weight (kDa)

10.29

Isoelectric Point (pI)

45.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 47 - 104 1.1e-10 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 5
AccIII TCCGGA 1 cut(s) 60
AciI CCGC 3 cut(s) 235, 262, 283
AcsI RAATTY 1 cut(s) 102
AcuI CTGAAG 1 cut(s) 159
AgsI TTSAA 5 cut(s) 47, 100, 133, 219, 250
Aor13HI TCCGGA 1 cut(s) 60
AoxI GGCC 1 cut(s) 304
ApoI RAATTY 1 cut(s) 102
AspLEI GCGC 1 cut(s) 6
AsuHPI GGTGA 1 cut(s) 239
BbsI GAAGAC 2 cut(s) 35, 165
BfaI CTAG 1 cut(s) 358
BpiI GAAGAC 2 cut(s) 35, 165
BsaWI WCCGGW 1 cut(s) 60
Bse3DI GCAATG 1 cut(s) 229
BseAI TCCGGA 1 cut(s) 60
BseGI GGATG 1 cut(s) 111
BseMI GCAATG 1 cut(s) 229
BshFI GGCC 1 cut(s) 306
BsiSI CCGG 1 cut(s) 61
BslFI GGGAC 1 cut(s) 326
BsmFI GGGAC 1 cut(s) 326
BsnI GGCC 1 cut(s) 306
Bsp13I TCCGGA 1 cut(s) 60
Bsp143I GATC 1 cut(s) 159
BspACI CCGC 3 cut(s) 235, 262, 283
BspANI GGCC 1 cut(s) 306
BspEI TCCGGA 1 cut(s) 60
BsrDI GCAATG 1 cut(s) 229
BssMI GATC 1 cut(s) 159
Bst6I CTCTTC 1 cut(s) 233
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 1 cut(s) 111
BstHHI GCGC 1 cut(s) 6
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstV2I GAAGAC 2 cut(s) 35, 165
BsuRI GGCC 1 cut(s) 306
BtsCI GGATG 1 cut(s) 111
CfoI GCGC 1 cut(s) 6
CviJI RGCY 1 cut(s) 306
CviKI_1 RGCY 1 cut(s) 306
DdeI CTNAG 1 cut(s) 156
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
Eam1104I CTCTTC 1 cut(s) 233
EarI CTCTTC 1 cut(s) 233
EciI GGCGGA 2 cut(s) 250, 277
Eco57I CTGAAG 1 cut(s) 159
FaiI YATR 1 cut(s) 74
FaqI GGGAC 1 cut(s) 326
FokI GGATG 1 cut(s) 98
FspAI RTGCGCAY 1 cut(s) 5
FspBI CTAG 1 cut(s) 358
FspI TGCGCA 1 cut(s) 5
GlaI GCGC 1 cut(s) 5
HaeIII GGCC 1 cut(s) 306
HapII CCGG 1 cut(s) 61
HhaI GCGC 1 cut(s) 6
Hin6I GCGC 1 cut(s) 4
HinP1I GCGC 1 cut(s) 4
HpaII CCGG 1 cut(s) 61
HphI GGTGA 1 cut(s) 239
Hpy188III TCNNGA 2 cut(s) 61, 311
HpyAV CCTTC 1 cut(s) 317
HpyCH4V TGCA 1 cut(s) 69
HpyF3I CTNAG 1 cut(s) 156
HspAI GCGC 1 cut(s) 4
Kpn2I TCCGGA 1 cut(s) 60
Kzo9I GATC 1 cut(s) 159
LpnPI CCDG 3 cut(s) 74, 129, 333
MaeI CTAG 1 cut(s) 358
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 3 cut(s) 35, 165, 250
MluCI AATT 3 cut(s) 50, 55, 102
MnlI CCTC 3 cut(s) 57, 112, 225
MroI TCCGGA 1 cut(s) 60
MseI TTAA 2 cut(s) 54, 207
MspI CCGG 1 cut(s) 61
NdeII GATC 1 cut(s) 159
NsbI TGCGCA 1 cut(s) 5
SaqAI TTAA 2 cut(s) 54, 207
Sau3AI GATC 1 cut(s) 159
SetI ASST 2 cut(s) 68, 128
Sse9I AATT 3 cut(s) 50, 55, 102
SsiI CCGC 3 cut(s) 235, 262, 283
SspMI CTAG 1 cut(s) 358
TasI AATT 3 cut(s) 50, 55, 102
Tru1I TTAA 2 cut(s) 54, 207
Tru9I TTAA 2 cut(s) 54, 207
TspDTI ATGAA 2 cut(s) 19, 89
XapI RAATTY 1 cut(s) 102
XspI CTAG 1 cut(s) 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.