Rh2CG606200

Ribosomal_S15

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
78200724 .. 78220100
19377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG606200.1

Sequence Viewer

Length: 237 bp
ATGAGTTGTCGACCATTGGCACAACTCACAACTAAGATCAAGCATTTGCCTTCAGTTTTACACAAAAAGGATAAGCACTCTCTTAAGGGTCTTCAAGCAATGGTGCAGAGGCGGAAGAGATTATTGAAGTATCTTTGGCGGAGTGATTGGGTTTCTTACTGCCTTTTTCTCTCCAAACTTGGCCTTCGGGACACACCAGATTACAAACAAGAATACAAGAAACATTACAAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

9.45

Weight (kDa)

10.2

Isoelectric Point (pI)

58.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S15 PF00312 6 - 63 3.5e-14 Ribosomal protein S15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 10
AciI CCGC 2 cut(s) 112, 139
AcuI CTGAAG 1 cut(s) 36
AflII CTTAAG 1 cut(s) 83
AgsI TTSAA 2 cut(s) 95, 127
AoxI GGCC 1 cut(s) 181
BbsI GAAGAC 1 cut(s) 83
BfaI CTAG 1 cut(s) 235
BfrI CTTAAG 1 cut(s) 83
BpiI GAAGAC 1 cut(s) 83
Bse3DI GCAATG 1 cut(s) 105
BseMI GCAATG 1 cut(s) 105
BsgI GTGCAG 1 cut(s) 125
BshFI GGCC 1 cut(s) 183
BslFI GGGAC 1 cut(s) 203
BsmFI GGGAC 1 cut(s) 203
BsnI GGCC 1 cut(s) 183
Bsp143I GATC 1 cut(s) 36
BspACI CCGC 2 cut(s) 112, 139
BspANI GGCC 1 cut(s) 183
BspTI CTTAAG 1 cut(s) 83
BsrDI GCAATG 1 cut(s) 105
BssMI GATC 1 cut(s) 36
Bst6I CTCTTC 1 cut(s) 110
BstAFI CTTAAG 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 33
BstKTI GATC 1 cut(s) 39
BstMBI GATC 1 cut(s) 36
BstV2I GAAGAC 1 cut(s) 83
BsuRI GGCC 1 cut(s) 183
CviJI RGCY 1 cut(s) 183
CviKI_1 RGCY 1 cut(s) 183
DdeI CTNAG 1 cut(s) 33
DpnI GATC 1 cut(s) 38
DpnII GATC 1 cut(s) 36
Eam1104I CTCTTC 1 cut(s) 110
EarI CTCTTC 1 cut(s) 110
EciI GGCGGA 2 cut(s) 127, 154
Eco57I CTGAAG 1 cut(s) 36
FaqI GGGAC 1 cut(s) 203
FblI GTMKAC 1 cut(s) 10
FspBI CTAG 1 cut(s) 235
HaeIII GGCC 1 cut(s) 183
HincII GTYRAC 1 cut(s) 11
HindII GTYRAC 1 cut(s) 11
Hpy166II GTNNAC 1 cut(s) 11
Hpy188III TCNNGA 1 cut(s) 188
Hpy8I GTNNAC 1 cut(s) 11
HpyAV CCTTC 2 cut(s) 60, 194
HpyCH4V TGCA 1 cut(s) 106
HpyF3I CTNAG 1 cut(s) 33
Kzo9I GATC 1 cut(s) 36
LpnPI CCDG 1 cut(s) 210
MaeI CTAG 1 cut(s) 235
MalI GATC 1 cut(s) 38
MboI GATC 1 cut(s) 36
MboII GAAGA 2 cut(s) 83, 127
MnlI CCTC 1 cut(s) 102
MseI TTAA 1 cut(s) 84
MspCI CTTAAG 1 cut(s) 83
NdeII GATC 1 cut(s) 36
SalI GTCGAC 1 cut(s) 9
SaqAI TTAA 1 cut(s) 84
Sau3AI GATC 1 cut(s) 36
SgeI CNNG 7 cut(s) 52, 107, 191, 200, 209, 221, 229
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
SsiI CCGC 2 cut(s) 112, 139
SspMI CTAG 1 cut(s) 235
TaqI TCGA 1 cut(s) 10
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
Vha464I CTTAAG 1 cut(s) 83
XmiI GTMKAC 1 cut(s) 10
XspI CTAG 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.