Rmu_sc0004565.1_g000003

Ribosomal_S15

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004565.1
Physical Location & Seq
Reverse (-)
15899 .. 16265
367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004565.1_g000003.1.cds

Sequence Viewer

Length: 273 bp
atgctggtttacggaggtctattaacctttcctcttcctgattgtcctgcagtggcacaactcacaactaagatcaagcatttgccttcagttttacacaaaaaggataagcactctcttaagggtcttcaagcaatggtgcagaggcggaagagattattgaagtatctttggcggagtgattgggtttcttactgcctttttctctccaaacttggccttcgggacacaccagattacaaacaagaatacaagaaacattacaagaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.65

Weight (kDa)

9.97

Isoelectric Point (pI)

50.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 148, 175
AcuI CTGAAG 1 cut(s) 72
AflII CTTAAG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 131, 163
AoxI GGCC 1 cut(s) 217
BbsI GAAGAC 1 cut(s) 119
BfaI CTAG 1 cut(s) 271
BfmI CTRYAG 1 cut(s) 48
BfrI CTTAAG 1 cut(s) 119
BpiI GAAGAC 1 cut(s) 119
Bse3DI GCAATG 1 cut(s) 141
BseMI GCAATG 1 cut(s) 141
BsgI GTGCAG 1 cut(s) 161
BshFI GGCC 1 cut(s) 219
BslFI GGGAC 1 cut(s) 239
BsmFI GGGAC 1 cut(s) 239
BsnI GGCC 1 cut(s) 219
Bsp143I GATC 1 cut(s) 72
BspACI CCGC 2 cut(s) 148, 175
BspANI GGCC 1 cut(s) 219
BspMAI CTGCAG 1 cut(s) 52
BspTI CTTAAG 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 141
BssMI GATC 1 cut(s) 72
Bst6I CTCTTC 2 cut(s) 39, 146
BstAFI CTTAAG 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 1 cut(s) 75
BstMBI GATC 1 cut(s) 72
BstSFI CTRYAG 1 cut(s) 48
BstV2I GAAGAC 1 cut(s) 119
BsuRI GGCC 1 cut(s) 219
BtsI GCAGTG 1 cut(s) 57
BtsIMutI CAGTG 1 cut(s) 57
CviJI RGCY 1 cut(s) 219
CviKI_1 RGCY 1 cut(s) 219
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
Eam1104I CTCTTC 2 cut(s) 39, 146
EarI CTCTTC 2 cut(s) 39, 146
EciI GGCGGA 2 cut(s) 163, 190
Eco57I CTGAAG 1 cut(s) 72
FaqI GGGAC 1 cut(s) 239
FspBI CTAG 1 cut(s) 271
HaeIII GGCC 1 cut(s) 219
Hpy166II GTNNAC 1 cut(s) 10
Hpy188III TCNNGA 2 cut(s) 38, 224
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 2 cut(s) 96, 230
HpyCH4V TGCA 2 cut(s) 50, 142
HpyF3I CTNAG 1 cut(s) 69
Kzo9I GATC 1 cut(s) 72
LpnPI CCDG 3 cut(s) 51, 60, 246
MaeI CTAG 1 cut(s) 271
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 3 cut(s) 26, 119, 163
MnlI CCTC 3 cut(s) 8, 42, 138
MseI TTAA 2 cut(s) 23, 120
MspCI CTTAAG 1 cut(s) 119
NdeII GATC 1 cut(s) 72
PstI CTGCAG 1 cut(s) 52
SaqAI TTAA 2 cut(s) 23, 120
Sau3AI GATC 1 cut(s) 72
SetI ASST 2 cut(s) 19, 29
SfcI CTRYAG 1 cut(s) 48
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
SsiI CCGC 2 cut(s) 148, 175
SspMI CTAG 1 cut(s) 271
Tru1I TTAA 2 cut(s) 23, 120
Tru9I TTAA 2 cut(s) 23, 120
TscAI CASTG 1 cut(s) 57
TspGWI ACGGA 1 cut(s) 27
TspRI CASTG 1 cut(s) 57
Vha464I CTTAAG 1 cut(s) 119
XspI CTAG 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.