Rmu_sc0017323.1_g000001

Ribosomal_S15

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017323.1
Physical Location & Seq
Forward (+)
10241 .. 12789
2549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017323.1_g000001.1.cds

Sequence Viewer

Length: 315 bp
atgtcttctgcagaaaagctgaaaattgagcttggcaaagttagagatgaatttaaaatgtcagagtcagattgtggttctgcacgagttcaagtggcacaactcacaactaagatcaagcatctatcttcagttctacacaaaaaggataagcattcactcaagggtcttcaagcaatggtgcagaggaggaaaaagctattaaagtatctccgaagaactgactgggactcttactgccttgttctctccaaacttggtctccgggacacgccagatgccaaacaagagtacaagaaacattacaagaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

12.12

Weight (kDa)

9.93

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 50
AcuI CTGAAG 1 cut(s) 114
AfaI GTAC 1 cut(s) 293
AgsI TTSAA 2 cut(s) 92, 173
AluBI AGCT 3 cut(s) 19, 31, 199
AluI AGCT 3 cut(s) 19, 31, 199
Alw26I GTCTC 1 cut(s) 266
ApoI RAATTY 1 cut(s) 50
AsuC2I CCSGG 1 cut(s) 266
BauI CACGAG 1 cut(s) 84
BbsI GAAGAC 1 cut(s) 161
BcnI CCSGG 1 cut(s) 266
BcoDI GTCTC 1 cut(s) 266
BfmI CTRYAG 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 266
BmrFI CCNGG 1 cut(s) 266
BmrI ACTGGG 1 cut(s) 235
BmsI GCATC 2 cut(s) 130, 268
BmuI ACTGGG 1 cut(s) 235
BpiI GAAGAC 1 cut(s) 161
BpuEI CTTGAG 1 cut(s) 146
BpuMI CCSGG 1 cut(s) 266
BsaI GGTCTC 1 cut(s) 266
BsaXI ACNNNNNCTCC 2 cut(s) 246, 276
Bse1I ACTGG 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 183
BseMI GCAATG 1 cut(s) 183
BseNI ACTGG 1 cut(s) 230
BseRI GAGGAG 1 cut(s) 202
BsgI GTGCAG 2 cut(s) 66, 203
BsiSI CCGG 1 cut(s) 265
BslFI GGGAC 2 cut(s) 242, 281
BsmAI GTCTC 1 cut(s) 266
BsmFI GGGAC 2 cut(s) 242, 281
BsmI GAATGC 1 cut(s) 154
Bso31I GGTCTC 1 cut(s) 266
Bsp143I GATC 1 cut(s) 114
BspMAI CTGCAG 1 cut(s) 13
BspTNI GGTCTC 1 cut(s) 266
BsrDI GCAATG 1 cut(s) 183
BsrI ACTGG 1 cut(s) 230
BssMI GATC 1 cut(s) 114
BssSI CACGAG 1 cut(s) 84
Bst2BI CACGAG 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 266
BstMBI GATC 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 264
BstSFI CTRYAG 1 cut(s) 9
BstV2I GAAGAC 1 cut(s) 161
Csp6I GTAC 1 cut(s) 292
CviJI RGCY 3 cut(s) 19, 31, 199
CviKI_1 RGCY 3 cut(s) 19, 31, 199
CviQI GTAC 1 cut(s) 292
DdeI CTNAG 1 cut(s) 111
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
DraI TTTAAA 1 cut(s) 55
Eco31I GGTCTC 1 cut(s) 266
Eco57I CTGAAG 1 cut(s) 114
FaqI GGGAC 2 cut(s) 242, 281
HapII CCGG 1 cut(s) 265
HinfI GANTC 2 cut(s) 65, 230
HpaII CCGG 1 cut(s) 265
Hpy188I TCNGA 3 cut(s) 64, 70, 215
HpyCH4V TGCA 3 cut(s) 11, 83, 184
HpyF3I CTNAG 1 cut(s) 111
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 3 cut(s) 211, 278, 288
LweI GCATC 2 cut(s) 130, 268
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 3 cut(s) 120, 161, 228
MluCI AATT 3 cut(s) 24, 50, 310
MlyI GAGTC 2 cut(s) 74, 224
MnlI CCTC 2 cut(s) 180, 183
MseI TTAA 2 cut(s) 54, 203
MspI CCGG 1 cut(s) 265
MspR9I CCNGG 1 cut(s) 266
Mva1269I GAATGC 1 cut(s) 154
NciI CCSGG 1 cut(s) 266
NdeII GATC 1 cut(s) 114
PctI GAATGC 1 cut(s) 154
PfoI TCCNGGA 1 cut(s) 264
PleI GAGTC 2 cut(s) 73, 224
PpsI GAGTC 2 cut(s) 73, 224
PstI CTGCAG 1 cut(s) 13
RsaI GTAC 1 cut(s) 293
RsaNI GTAC 1 cut(s) 292
SaqAI TTAA 2 cut(s) 54, 203
Sau3AI GATC 1 cut(s) 114
SchI GAGTC 2 cut(s) 74, 224
ScrFI CCNGG 1 cut(s) 266
SetI ASST 3 cut(s) 21, 33, 201
SfaNI GCATC 2 cut(s) 130, 268
SfcI CTRYAG 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 3 cut(s) 24, 50, 310
StyD4I CCNGG 1 cut(s) 264
TasI AATT 3 cut(s) 24, 50, 310
TatI WGTACW 1 cut(s) 291
Tru1I TTAA 2 cut(s) 54, 203
Tru9I TTAA 2 cut(s) 54, 203
TspDTI ATGAA 1 cut(s) 63
XapI RAATTY 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.