RchiOBHm_Chr7g0215881

Leucine-rich repeats, typical (most populated) subfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
33529656 .. 33530069
414 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19314

Sequence Viewer

Length: 261 bp
ATGGAAGATGAGCAAATAAGAAGATATGGGGATTTGGAGACATATTGCTTAAGTAATGTGCTTTCTACAGTTGGGATGGAGTCTTTGCTTCGGACAGTTCATTTCATCTGCAAATTATGGTACAACATAAGTCTCAATCCCTTGAGCTTTCAAAACCTCTCATTTCCAGATTTTATGTCTTGTCTTTTGTTCACAGCTACTAATAATTATGAGGAAACTCCTCCCAATTTTGATTCCTTTTATGATAAGTTTATAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

10.15

Weight (kDa)

4.34

Isoelectric Point (pI)

52.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 122
AflII CTTAAG 1 cut(s) 49
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 2 cut(s) 147, 197
AluI AGCT 2 cut(s) 147, 197
Alw26I GTCTC 2 cut(s) 32, 137
BccI CCATC 1 cut(s) 70
BcoDI GTCTC 2 cut(s) 32, 137
BfaI CTAG 1 cut(s) 259
BfmI CTRYAG 1 cut(s) 66
BfrI CTTAAG 1 cut(s) 49
BpuEI CTTGAG 1 cut(s) 163
BseGI GGATG 1 cut(s) 81
BseRI GAGGAG 1 cut(s) 210
BsmAI GTCTC 2 cut(s) 32, 137
BspTI CTTAAG 1 cut(s) 49
Bst4CI ACNGT 2 cut(s) 70, 97
BstAFI CTTAAG 1 cut(s) 49
BstF5I GGATG 1 cut(s) 81
BstMAI GTCTC 2 cut(s) 32, 137
BstSFI CTRYAG 1 cut(s) 66
BtsCI GGATG 1 cut(s) 81
Csp6I GTAC 1 cut(s) 121
CviJI RGCY 2 cut(s) 147, 197
CviKI_1 RGCY 2 cut(s) 147, 197
CviQI GTAC 1 cut(s) 121
FaiI YATR 8 cut(s) 27, 43, 118, 128, 176, 210, 243, 254
FokI GGATG 1 cut(s) 88
FspBI CTAG 1 cut(s) 259
HinfI GANTC 2 cut(s) 80, 233
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 1 cut(s) 192
HpyCH4III ACNGT 2 cut(s) 70, 97
HpyCH4V TGCA 1 cut(s) 111
LpnPI CCDG 1 cut(s) 180
MaeI CTAG 1 cut(s) 259
MboII GAAGA 2 cut(s) 17, 33
MluCI AATT 3 cut(s) 113, 205, 226
MlyI GAGTC 1 cut(s) 89
MnlI CCTC 3 cut(s) 167, 205, 231
MseI TTAA 1 cut(s) 50
MspCI CTTAAG 1 cut(s) 49
PfeI GAWTC 1 cut(s) 233
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SaqAI TTAA 1 cut(s) 50
SchI GAGTC 1 cut(s) 89
SetI ASST 3 cut(s) 149, 159, 199
SfcI CTRYAG 1 cut(s) 66
SgeI CNNG 3 cut(s) 154, 179, 192
SmlI CTYRAG 2 cut(s) 49, 142
SmoI CTYRAG 2 cut(s) 49, 142
Sse9I AATT 3 cut(s) 113, 205, 226
SspMI CTAG 1 cut(s) 259
TaaI ACNGT 2 cut(s) 70, 97
TasI AATT 3 cut(s) 113, 205, 226
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 89, 94
Vha464I CTTAAG 1 cut(s) 49
XspI CTAG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.