Rmu_sc0000449.1_g000008

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000449.1
OG0000886
Physical Location & Seq
Forward (+)
38986 .. 39558
573 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000449.1_g000008.1.cds

Sequence Viewer

Length: 573 bp
atgtggagagcgaagaagaagatgaagccatcgccaccgcggaggagccacggcgtggtttcgaatatggagactgagaaggaccacgatccatctttcagtcgacgaagatgggaggatttagacgaggactgtctagcaaatgtgtttacaaaagttggaatggagtctttgctcttggctgttccttatgtatgcaaatcatggtacgcaactactctcaatcctttaagctggaggcttctctcttttccagactttgagccttatcctctgtttactgctccttctgatcatgatgttaatgttgtacttgcgcctgatgatattaacatagaagaggttgaacccaagtcttttggatcgttttacgatcagtttgtagaagaatatggattcgataggagtcgtttttcgatcacagcttttgtaaaaaatgtagtgaatcgtagccatggaaaggctatttatgtcaagctacctacattttgtactgatgagagcgaagaagaagatgaagccatcgccaccgccgaggagccacggcgtggtttcgaatatggagaacactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box

Protein Analysis

190

Amino Acids

22.0

Weight (kDa)

4.95

Isoelectric Point (pI)

70.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 55, 548
AccI GTMKAC 1 cut(s) 103
AccII CGCG 1 cut(s) 40
AciI CCGC 3 cut(s) 38, 40, 531
AclWI GGATC 2 cut(s) 83, 370
AdeI CACNNNGTG 2 cut(s) 55, 548
AfaI GTAC 3 cut(s) 209, 312, 493
AfiI CCNNNNNNNGG 3 cut(s) 55, 460, 548
AgsI TTSAA 1 cut(s) 347
AluBI AGCT 3 cut(s) 234, 425, 478
AluI AGCT 3 cut(s) 234, 425, 478
Alw26I GTCTC 1 cut(s) 65
AlwI GGATC 2 cut(s) 83, 370
AspLEI GCGC 1 cut(s) 319
AspS9I GGNCC 1 cut(s) 82
AsuII TTCGAA 2 cut(s) 62, 555
AvaII GGWCC 1 cut(s) 82
BccI CCATC 4 cut(s) 37, 100, 105, 530
BceAI ACGGC 2 cut(s) 67, 560
BclI TGATCA 1 cut(s) 292
BcoDI GTCTC 1 cut(s) 65
BfaI CTAG 1 cut(s) 137
Bme18I GGWCC 1 cut(s) 82
BmgT120I GGNCC 1 cut(s) 82
BmiI GGNNCC 2 cut(s) 47, 540
BpmI CTGGAG 1 cut(s) 256
Bpu14I TTCGAA 2 cut(s) 62, 555
BsaJI CCNNGG 5 cut(s) 38, 49, 454, 534, 542
Bsc4I CCNNNNNNNGG 3 cut(s) 55, 460, 548
BseDI CCNNGG 5 cut(s) 38, 49, 454, 534, 542
BseLI CCNNNNNNNGG 3 cut(s) 55, 460, 548
BseMII CTCAG 1 cut(s) 66
BseRI GAGGAG 2 cut(s) 58, 551
Bsh1236I CGCG 1 cut(s) 40
BslI CCNNNNNNNGG 3 cut(s) 55, 460, 548
BsmAI GTCTC 1 cut(s) 65
Bsp119I TTCGAA 2 cut(s) 62, 555
Bsp143I GATC 5 cut(s) 88, 292, 362, 373, 417
Bsp19I CCATGG 1 cut(s) 454
BspACI CCGC 3 cut(s) 38, 40, 531
BspCNI CTCAG 1 cut(s) 67
BspFNI CGCG 1 cut(s) 40
BspHI TCATGA 1 cut(s) 295
BspLI GGNNCC 2 cut(s) 47, 540
BspPI GGATC 2 cut(s) 83, 370
BspT104I TTCGAA 2 cut(s) 62, 555
BssECI CCNNGG 5 cut(s) 38, 49, 454, 534, 542
BssMI GATC 5 cut(s) 88, 292, 362, 373, 417
BssT1I CCWWGG 1 cut(s) 454
Bst4CI ACNGT 1 cut(s) 134
Bst6I CTCTTC 1 cut(s) 333
BstBI TTCGAA 2 cut(s) 62, 555
BstDEI CTNAG 1 cut(s) 75
BstDSI CCRYGG 4 cut(s) 38, 49, 454, 542
BstFNI CGCG 1 cut(s) 40
BstHHI GCGC 1 cut(s) 319
BstKTI GATC 5 cut(s) 91, 295, 365, 376, 420
BstMAI GTCTC 1 cut(s) 65
BstMBI GATC 5 cut(s) 88, 292, 362, 373, 417
BstUI CGCG 1 cut(s) 40
BtgI CCRYGG 4 cut(s) 38, 49, 454, 542
BtgZI GCGATG 2 cut(s) 15, 508
BtsIMutI CAGTG 1 cut(s) 568
CciI TCATGA 1 cut(s) 295
CfoI GCGC 1 cut(s) 319
Cfr13I GGNCC 1 cut(s) 82
Cfr42I CCGCGG 1 cut(s) 41
Csp6I GTAC 3 cut(s) 208, 311, 492
CviAII CATG 3 cut(s) 204, 296, 455
CviQI GTAC 3 cut(s) 208, 311, 492
DdeI CTNAG 1 cut(s) 75
DpnI GATC 5 cut(s) 90, 294, 364, 375, 419
DpnII GATC 5 cut(s) 88, 292, 362, 373, 417
DraIII CACNNNGTG 2 cut(s) 55, 548
Eam1104I CTCTTC 1 cut(s) 333
EarI CTCTTC 1 cut(s) 333
Eco130I CCWWGG 1 cut(s) 454
Eco47I GGWCC 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 454
ErhI CCWWGG 1 cut(s) 454
FaeI CATG 3 cut(s) 207, 299, 458
FatI CATG 3 cut(s) 203, 295, 454
FbaI TGATCA 1 cut(s) 292
FblI GTMKAC 1 cut(s) 103
FspBI CTAG 1 cut(s) 137
GlaI GCGC 1 cut(s) 318
GsuI CTGGAG 1 cut(s) 256
HhaI GCGC 1 cut(s) 319
Hin1II CATG 3 cut(s) 207, 299, 458
Hin6I GCGC 1 cut(s) 317
HinP1I GCGC 1 cut(s) 317
HincII GTYRAC 1 cut(s) 104
HindII GTYRAC 1 cut(s) 104
HinfI GANTC 4 cut(s) 167, 396, 406, 445
Hpy166II GTNNAC 3 cut(s) 104, 150, 279
Hpy188I TCNGA 1 cut(s) 292
Hpy188III TCNNGA 2 cut(s) 254, 296
Hpy8I GTNNAC 3 cut(s) 104, 150, 279
Hpy99I CGWCG 1 cut(s) 108
HpyAV CCTTC 2 cut(s) 73, 297
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 198
HpyF3I CTNAG 1 cut(s) 75
Hsp92II CATG 3 cut(s) 207, 299, 458
HspAI GCGC 1 cut(s) 317
Ksp22I TGATCA 1 cut(s) 292
KspI CCGCGG 1 cut(s) 41
Kzo9I GATC 5 cut(s) 88, 292, 362, 373, 417
LmnI GCTCC 3 cut(s) 45, 289, 538
LpnPI CCDG 3 cut(s) 220, 267, 333
MaeI CTAG 1 cut(s) 137
MalI GATC 5 cut(s) 90, 294, 364, 375, 419
MboI GATC 5 cut(s) 88, 292, 362, 373, 417
MboII GAAGA 9 cut(s) 25, 28, 31, 120, 350, 398, 518, 521, 524
MlyI GAGTC 2 cut(s) 176, 415
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 7 cut(s) 36, 109, 121, 231, 282, 334, 529
MseI TTAA 3 cut(s) 230, 303, 330
MspA1I CMGCKG 1 cut(s) 40
MvnI CGCG 1 cut(s) 40
NcoI CCATGG 1 cut(s) 454
NdeII GATC 5 cut(s) 88, 292, 362, 373, 417
NlaIII CATG 3 cut(s) 207, 299, 458
NlaIV GGNNCC 2 cut(s) 47, 540
NmeAIII GCCGAG 1 cut(s) 559
NspV TTCGAA 2 cut(s) 62, 555
PagI TCATGA 1 cut(s) 295
PcsI WCGNNNNNNNCGW 1 cut(s) 531
PfeI GAWTC 2 cut(s) 396, 445
PflMI CCANNNNNTGG 2 cut(s) 55, 548
PleI GAGTC 2 cut(s) 175, 414
PpsI GAGTC 2 cut(s) 175, 414
PspN4I GGNNCC 2 cut(s) 47, 540
PspPI GGNCC 1 cut(s) 82
RsaI GTAC 3 cut(s) 209, 312, 493
RsaNI GTAC 3 cut(s) 208, 311, 492
SacII CCGCGG 1 cut(s) 41
SalI GTCGAC 1 cut(s) 102
SaqAI TTAA 3 cut(s) 230, 303, 330
Sau3AI GATC 5 cut(s) 88, 292, 362, 373, 417
Sau96I GGNCC 1 cut(s) 82
SchI GAGTC 2 cut(s) 176, 415
SetI ASST 5 cut(s) 236, 345, 427, 480, 484
Sfr303I CCGCGG 1 cut(s) 41
SfuI TTCGAA 2 cut(s) 62, 555
SgrBI CCGCGG 1 cut(s) 41
SinI GGWCC 1 cut(s) 82
SsiI CCGC 3 cut(s) 38, 40, 531
SspMI CTAG 1 cut(s) 137
StyI CCWWGG 1 cut(s) 454
TaaI ACNGT 1 cut(s) 134
TaqI TCGA 5 cut(s) 62, 103, 399, 416, 555
TatI WGTACW 2 cut(s) 310, 491
TfiI GAWTC 2 cut(s) 396, 445
Tru1I TTAA 3 cut(s) 230, 303, 330
Tru9I TTAA 3 cut(s) 230, 303, 330
TspDTI ATGAA 2 cut(s) 38, 531
Van91I CCANNNNNTGG 2 cut(s) 55, 548
VpaK11BI GGWCC 1 cut(s) 82
XmiI GTMKAC 1 cut(s) 103
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.