Rmu_sc0001468.1_g000012

U3 small nucleolar RNA-associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001468.1
Physical Location & Seq
Forward (+)
46939 .. 48412
1474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001468.1_g000012.1.cds

Sequence Viewer

Length: 306 bp
atggatactgcacaggcatatgtttggagacttcaaaactttgttcttggggagcatattctgaaaccaagaccagaaaaccctacacctgtgaagctgggggttggattgagcggatcaacctgcagtcaggaagcaggaagcagccgatgtagttatgtggacccatcggaaagaagcatctgtgcccatgatggggaagttgttggaattgcttgtgattcaactaatactcacatgataagtgctggatatcatggagacataaaggtctgggatttcaaggaaacgtggagtgccatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.01

Weight (kDa)

5.41

Isoelectric Point (pI)

26.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 269
Acc36I ACCTGC 1 cut(s) 131
AccBSI CCGCTC 1 cut(s) 114
AciI CCGC 1 cut(s) 114
AclWI GGATC 1 cut(s) 124
AfiI CCNNNNNNNGG 2 cut(s) 195, 196
AgsI TTSAA 3 cut(s) 35, 225, 283
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw26I GTCTC 2 cut(s) 22, 255
AlwI GGATC 1 cut(s) 124
ApeKI GCWGC 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 163
AvaII GGWCC 1 cut(s) 163
BaeGI GKGCMC 1 cut(s) 190
BbvI GCAGC 1 cut(s) 156
BccI CCATC 2 cut(s) 175, 188
BcoDI GTCTC 2 cut(s) 22, 255
BfaI CTAG 1 cut(s) 304
BfmI CTRYAG 1 cut(s) 124
BfuAI ACCTGC 1 cut(s) 131
BisI GCNGC 1 cut(s) 145
BlsI GCNGC 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 163
BmgT120I GGNCC 1 cut(s) 163
BmiI GGNNCC 1 cut(s) 165
BmsI GCATC 1 cut(s) 189
Bsc4I CCNNNNNNNGG 2 cut(s) 195, 196
BseLI CCNNNNNNNGG 2 cut(s) 195, 196
BseSI GKGCMC 1 cut(s) 190
BseXI GCAGC 1 cut(s) 156
BseYI CCCAGC 1 cut(s) 97
BslI CCNNNNNNNGG 2 cut(s) 195, 196
BsmAI GTCTC 2 cut(s) 22, 255
Bsp1286I GDGCHC 1 cut(s) 190
Bsp143I GATC 1 cut(s) 116
BspACI CCGC 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 165
BspMAI CTGCAG 1 cut(s) 128
BspMI ACCTGC 1 cut(s) 131
BspPI GGATC 1 cut(s) 124
BsrBI CCGCTC 1 cut(s) 114
BssMI GATC 1 cut(s) 116
BstKTI GATC 1 cut(s) 119
BstMAI GTCTC 2 cut(s) 22, 255
BstMBI GATC 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 124
BstSLI GKGCMC 1 cut(s) 190
BstV1I GCAGC 1 cut(s) 156
BveI ACCTGC 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 163
CviAII CATG 3 cut(s) 191, 238, 257
CviJI RGCY 2 cut(s) 97, 147
CviKI_1 RGCY 2 cut(s) 97, 147
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
DrdI GACNNNNNNGTC 1 cut(s) 269
DseDI GACNNNNNNGTC 1 cut(s) 269
Eco32I GATATC 1 cut(s) 254
Eco47I GGWCC 1 cut(s) 163
EcoRV GATATC 1 cut(s) 254
FaeI CATG 3 cut(s) 194, 241, 260
FaiI YATR 8 cut(s) 19, 21, 57, 159, 192, 239, 258, 266
FatI CATG 3 cut(s) 190, 237, 256
FauNDI CATATG 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 145
Fsp4HI GCNGC 1 cut(s) 145
FspBI CTAG 1 cut(s) 304
GluI GCNGC 1 cut(s) 145
GsaI CCCAGC 1 cut(s) 101
Hin1II CATG 3 cut(s) 194, 241, 260
HinfI GANTC 1 cut(s) 221
Hpy166II GTNNAC 1 cut(s) 163
Hpy188I TCNGA 2 cut(s) 63, 172
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 1 cut(s) 163
HpyCH4IV ACGT 1 cut(s) 290
HpyCH4V TGCA 2 cut(s) 11, 126
HpySE526I ACGT 1 cut(s) 290
Hsp92II CATG 3 cut(s) 194, 241, 260
Kzo9I GATC 1 cut(s) 116
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 8 cut(s) 83, 87, 102, 116, 123, 136, 234, 259
Lsp1109I GCAGC 1 cut(s) 156
LweI GCATC 1 cut(s) 189
MaeI CTAG 1 cut(s) 304
MaeII ACGT 1 cut(s) 290
MalI GATC 1 cut(s) 118
MbiI CCGCTC 1 cut(s) 114
MboI GATC 1 cut(s) 116
MhlI GDGCHC 1 cut(s) 190
MluCI AATT 1 cut(s) 210
MmeI TCCRAC 2 cut(s) 85, 187
NdeI CATATG 1 cut(s) 19
NdeII GATC 1 cut(s) 116
NlaIII CATG 3 cut(s) 194, 241, 260
NlaIV GGNNCC 1 cut(s) 165
PfeI GAWTC 1 cut(s) 221
PkrI GCNGC 1 cut(s) 146
PspFI CCCAGC 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 165
PspPI GGNCC 1 cut(s) 163
PstI CTGCAG 1 cut(s) 128
SatI GCNGC 1 cut(s) 145
Sau3AI GATC 1 cut(s) 116
Sau96I GGNCC 1 cut(s) 163
SduI GDGCHC 1 cut(s) 190
SetI ASST 5 cut(s) 91, 99, 125, 273, 293
SfaNI GCATC 1 cut(s) 189
SfcI CTRYAG 1 cut(s) 124
SinI GGWCC 1 cut(s) 163
Sse9I AATT 1 cut(s) 210
SsiI CCGC 1 cut(s) 114
SspMI CTAG 1 cut(s) 304
TaiI ACGT 1 cut(s) 293
TasI AATT 1 cut(s) 210
TfiI GAWTC 1 cut(s) 221
TseI GCWGC 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 163
XspI CTAG 1 cut(s) 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.