Rh4AG078300

U3 small nucleolar RNA-associated protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
15926094 .. 15926508
415 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG078300.1

Sequence Viewer

Length: 255 bp
ATGGATGGAAATCTTCAAGTTTGGGATGTCATCTTAGCAAGACAAATCGATGCATTGCATGTTGATGTGTCTGTGACGGCACTGTCTCTATCACCGAATATGGATATTTTAGCGACCTCCCATGTTGATCAAAATGGGGCTATCTTCGTTTCAGAATTTACTGATTTCATCAAAACTTTGTCTCCAACATCCCTGGATATGGAACTTCGAATTCTTCAGATTGTGGGTGATGAGGATGAAGAAGAGTCAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.3

Weight (kDa)

4.05

Isoelectric Point (pI)

43.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Beta-prop_WDR36-Utp21_2nd PF25168 1 - 56 9.4e-10 WDR36/Utp21 second beta-propeller domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 82
AcsI RAATTY 2 cut(s) 155, 210
AcuI CTGAAG 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 199
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 1 cut(s) 192
Alw26I GTCTC 2 cut(s) 90, 186
ApoI RAATTY 2 cut(s) 155, 210
AsuHPI GGTGA 2 cut(s) 84, 239
AsuII TTCGAA 1 cut(s) 208
BceAI ACGGC 1 cut(s) 93
BciT130I CCWGG 1 cut(s) 194
BclI TGATCA 1 cut(s) 127
BcoDI GTCTC 2 cut(s) 90, 186
Bme1390I CCNGG 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 194
BmsI GCATC 1 cut(s) 40
Bpu14I TTCGAA 1 cut(s) 208
Bsa29I ATCGAT 1 cut(s) 48
BsaBI GATNNNNATC 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 192
BsaXI ACNNNNNCTCC 2 cut(s) 166, 196
Bsc4I CCNNNNNNNGG 1 cut(s) 199
Bse3DI GCAATG 1 cut(s) 53
Bse8I GATNNNNATC 1 cut(s) 9
BseBI CCWGG 1 cut(s) 194
BseCI ATCGAT 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 192
BseGI GGATG 4 cut(s) 10, 31, 188, 241
BseJI GATNNNNATC 1 cut(s) 9
BseLI CCNNNNNNNGG 1 cut(s) 199
BseMI GCAATG 1 cut(s) 53
BshVI ATCGAT 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 199
BsmAI GTCTC 2 cut(s) 90, 186
Bsp119I TTCGAA 1 cut(s) 208
Bsp143I GATC 1 cut(s) 127
BspDI ATCGAT 1 cut(s) 48
BspT104I TTCGAA 1 cut(s) 208
BsrDI GCAATG 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 192
BssMI GATC 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 1 cut(s) 84
Bst6I CTCTTC 1 cut(s) 237
BstBI TTCGAA 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 34
BstF5I GGATG 4 cut(s) 10, 31, 188, 241
BstKTI GATC 1 cut(s) 130
BstMAI GTCTC 2 cut(s) 90, 186
BstMBI GATC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 194
BstNSI RCATGY 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 192
Bsu15I ATCGAT 1 cut(s) 48
BsuTUI ATCGAT 1 cut(s) 48
BtsCI GGATG 4 cut(s) 10, 31, 188, 241
BtsIMutI CAGTG 1 cut(s) 80
ClaI ATCGAT 1 cut(s) 48
CviAII CATG 2 cut(s) 59, 122
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DdeI CTNAG 1 cut(s) 34
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
DrdI GACNNNNNNGTC 1 cut(s) 82
DseDI GACNNNNNNGTC 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 237
EarI CTCTTC 1 cut(s) 237
Eco57I CTGAAG 1 cut(s) 200
EcoRI GAATTC 1 cut(s) 210
EcoRII CCWGG 1 cut(s) 192
EcoT22I ATGCAT 1 cut(s) 55
FaeI CATG 2 cut(s) 62, 125
FaiI YATR 4 cut(s) 60, 101, 123, 200
FatI CATG 2 cut(s) 58, 121
FbaI TGATCA 1 cut(s) 127
FokI GGATG 4 cut(s) 17, 38, 175, 248
Hin1II CATG 2 cut(s) 62, 125
HinfI GANTC 1 cut(s) 245
HphI GGTGA 2 cut(s) 84, 239
Hpy188I TCNGA 3 cut(s) 154, 219, 250
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 53, 58
HpyF3I CTNAG 1 cut(s) 34
Hsp92II CATG 2 cut(s) 62, 125
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 179, 206
LweI GCATC 1 cut(s) 40
MaeIII GTNAC 1 cut(s) 73
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 5 cut(s) 5, 136, 206, 251, 254
MluCI AATT 2 cut(s) 155, 210
MlyI GAGTC 1 cut(s) 254
MmeI TCCRAC 1 cut(s) 209
MnlI CCTC 2 cut(s) 127, 226
Mph1103I ATGCAT 1 cut(s) 55
MslI CAYNNNNRTG 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NdeII GATC 1 cut(s) 127
NlaIII CATG 2 cut(s) 62, 125
NmuCI GTSAC 1 cut(s) 73
NsiI ATGCAT 1 cut(s) 55
NspI RCATGY 1 cut(s) 62
NspV TTCGAA 1 cut(s) 208
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
RseI CAYNNNNRTG 1 cut(s) 63
Sau3AI GATC 1 cut(s) 127
SchI GAGTC 1 cut(s) 254
ScrFI CCNGG 1 cut(s) 194
SetI ASST 1 cut(s) 119
SfaNI GCATC 1 cut(s) 40
SfuI TTCGAA 1 cut(s) 208
SgeI CNNG 6 cut(s) 29, 51, 71, 134, 205, 206
SmiMI CAYNNNNRTG 1 cut(s) 63
Sse9I AATT 2 cut(s) 155, 210
StyD4I CCNGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 84
TaqI TCGA 2 cut(s) 48, 208
TasI AATT 2 cut(s) 155, 210
TscAI CASTG 1 cut(s) 87
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 2 cut(s) 157, 252
TspRI CASTG 1 cut(s) 87
XapI RAATTY 2 cut(s) 155, 210
XceI RCATGY 1 cut(s) 62
Zsp2I ATGCAT 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.