Rw4G006370

U3 small nucleolar RNA-associated protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0001399
Physical Location & Seq
Reverse (-)
13189315 .. 13190180
866 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G006370.1

Sequence Viewer

Length: 429 bp
ATGTTTAAGCCTACTGGAAAAGGTGATGAAGAATCATCTAGAATAAAGACTGCTCTGGCACCATCAATATTCCTTCAAGCGCTTCAGTCATCTGCAGAAATGAAGAATTTTTCAGAATTTGCTGATTTCATCAAAACTTTGGCCCCATCATCCCTGGATATGGAACTTCGAATTCTTCAGATTGTAGGCGATGAGGATGAAGAGCCAGAAAAGTTGCTTCCATTTGAACTGCTTCTCGACTATTTTATACACGAGACTGCATGCAGAAAAATTTTTGACTTTGTGCAAGCTGTGATCAGGGTATTTCTGAAGTTTCTTCCTGGACAGATACATGGCAAAACAATTCGACGCCAGTCAAGATTACAGGATAAGGCAAGCAAACTCCTAGATAAGGCAAGCAAACTCCTAGACGTTCAATGCAACACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03008 map03008
Pfam Domains
Protein Families
ANAPC4_WD40 Utp21 WD40

Protein Analysis

142

Amino Acids

16.18

Weight (kDa)

6.14

Isoelectric Point (pI)

52.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Utp21 PF04192 9 - 132 1.4e-13 Utp21 specific WD40 associated putative domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 58
AcsI RAATTY 4 cut(s) 106, 116, 171, 270
AcuI CTGAAG 3 cut(s) 68, 161, 329
AcyI GRCGYC 1 cut(s) 349
AfeI AGCGCT 1 cut(s) 81
AfiI CCNNNNNNNGG 2 cut(s) 160, 391
AgsI TTSAA 3 cut(s) 77, 227, 416
AjnI CCWGG 2 cut(s) 153, 319
AluBI AGCT 1 cut(s) 290
AluI AGCT 1 cut(s) 290
Alw26I GTCTC 1 cut(s) 248
Aor51HI AGCGCT 1 cut(s) 81
AoxI GGCC 1 cut(s) 141
ApoI RAATTY 4 cut(s) 106, 116, 171, 270
Asp700I GAANNNNTTC 1 cut(s) 231
AspLEI GCGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 35
AsuII TTCGAA 1 cut(s) 169
BanI GGYRCC 1 cut(s) 58
BauI CACGAG 1 cut(s) 251
BccI CCATC 2 cut(s) 70, 154
BciT130I CCWGG 2 cut(s) 155, 321
BclI TGATCA 1 cut(s) 294
BcoDI GTCTC 1 cut(s) 248
BfaI CTAG 3 cut(s) 39, 386, 407
BfmI CTRYAG 1 cut(s) 93
BfoI RGCGCY 1 cut(s) 83
Bme1390I CCNGG 2 cut(s) 155, 321
BmgT120I GGNCC 1 cut(s) 142
BmiI GGNNCC 2 cut(s) 60, 144
BmrFI CCNGG 2 cut(s) 155, 321
BoxI GACNNNNGTC 1 cut(s) 352
Bpu14I TTCGAA 1 cut(s) 169
BsaHI GRCGYC 1 cut(s) 349
BsaJI CCNNGG 1 cut(s) 153
Bsc4I CCNNNNNNNGG 2 cut(s) 160, 391
Bse1I ACTGG 2 cut(s) 19, 352
BseBI CCWGG 2 cut(s) 155, 321
BseDI CCNNGG 1 cut(s) 153
BseGI GGATG 2 cut(s) 149, 202
BseLI CCNNNNNNNGG 2 cut(s) 160, 391
BseNI ACTGG 2 cut(s) 19, 352
BshFI GGCC 1 cut(s) 143
BshNI GGYRCC 1 cut(s) 58
BslI CCNNNNNNNGG 2 cut(s) 160, 391
BsmAI GTCTC 1 cut(s) 248
BsnI GGCC 1 cut(s) 143
Bsp119I TTCGAA 1 cut(s) 169
Bsp143I GATC 1 cut(s) 294
BspANI GGCC 1 cut(s) 143
BspLI GGNNCC 2 cut(s) 60, 144
BspMAI CTGCAG 1 cut(s) 97
BspQI GCTCTTC 1 cut(s) 195
BspT104I TTCGAA 1 cut(s) 169
BspT107I GGYRCC 1 cut(s) 58
BsrI ACTGG 2 cut(s) 19, 352
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 1 cut(s) 294
BssNI GRCGYC 1 cut(s) 349
BssSI CACGAG 1 cut(s) 251
Bst2BI CACGAG 1 cut(s) 251
Bst2UI CCWGG 2 cut(s) 155, 321
Bst6I CTCTTC 1 cut(s) 195
BstACI GRCGYC 1 cut(s) 349
BstBI TTCGAA 1 cut(s) 169
BstC8I GCNNGC 4 cut(s) 262, 288, 376, 397
BstENI CCTNNNNNAGG 1 cut(s) 389
BstF5I GGATG 2 cut(s) 149, 202
BstH2I RGCGCY 1 cut(s) 83
BstHHI GCGC 1 cut(s) 82
BstKTI GATC 1 cut(s) 297
BstMAI GTCTC 1 cut(s) 248
BstMBI GATC 1 cut(s) 294
BstNI CCWGG 2 cut(s) 155, 321
BstNSI RCATGY 1 cut(s) 264
BstPAI GACNNNNGTC 1 cut(s) 352
BstSCI CCNGG 2 cut(s) 153, 319
BstSFI CTRYAG 1 cut(s) 93
BsuRI GGCC 1 cut(s) 143
BtgZI GCGATG 1 cut(s) 204
BtsCI GGATG 2 cut(s) 149, 202
Cac8I GCNNGC 4 cut(s) 262, 288, 376, 397
CfoI GCGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 142
CseI GACGC 1 cut(s) 357
CviAII CATG 3 cut(s) 261, 332, 426
CviJI RGCY 4 cut(s) 10, 143, 205, 290
CviKI_1 RGCY 4 cut(s) 10, 143, 205, 290
DpnI GATC 1 cut(s) 296
DpnII GATC 1 cut(s) 294
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco47III AGCGCT 1 cut(s) 81
Eco57I CTGAAG 3 cut(s) 68, 161, 329
EcoNI CCTNNNNNAGG 1 cut(s) 389
EcoRI GAATTC 1 cut(s) 171
EcoRII CCWGG 2 cut(s) 153, 319
FaeI CATG 3 cut(s) 264, 335, 429
FaiI YATR 5 cut(s) 161, 248, 262, 333, 427
FatI CATG 3 cut(s) 260, 331, 425
FbaI TGATCA 1 cut(s) 294
FokI GGATG 2 cut(s) 136, 209
FspBI CTAG 3 cut(s) 39, 386, 407
GlaI GCGC 1 cut(s) 81
HaeII RGCGCY 1 cut(s) 83
HaeIII GGCC 1 cut(s) 143
HgaI GACGC 1 cut(s) 357
HhaI GCGC 1 cut(s) 82
Hin1I GRCGYC 1 cut(s) 349
Hin1II CATG 3 cut(s) 264, 335, 429
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
HinfI GANTC 1 cut(s) 32
HphI GGTGA 1 cut(s) 35
Hpy188I TCNGA 3 cut(s) 115, 180, 309
Hpy188III TCNNGA 3 cut(s) 39, 236, 357
Hpy99I CGWCG 1 cut(s) 351
HpyAV CCTTC 1 cut(s) 83
HpyCH4IV ACGT 1 cut(s) 411
HpyCH4V TGCA 5 cut(s) 95, 260, 264, 286, 420
HpySE526I ACGT 1 cut(s) 411
Hsp92I GRCGYC 1 cut(s) 349
Hsp92II CATG 3 cut(s) 264, 335, 429
HspAI GCGC 1 cut(s) 80
Ksp22I TGATCA 1 cut(s) 294
Kzo9I GATC 1 cut(s) 294
LguI GCTCTTC 1 cut(s) 195
LpnPI CCDG 9 cut(s) 41, 140, 167, 219, 283, 306, 333, 350, 365
MaeI CTAG 3 cut(s) 39, 386, 407
MaeII ACGT 1 cut(s) 411
MalI GATC 1 cut(s) 296
MboI GATC 1 cut(s) 294
MboII GAAGA 5 cut(s) 41, 115, 167, 212, 308
MluCI AATT 5 cut(s) 106, 116, 171, 270, 342
MnlI CCTC 1 cut(s) 187
MroXI GAANNNNTTC 1 cut(s) 231
MseI TTAA 1 cut(s) 6
MspR9I CCNGG 2 cut(s) 155, 321
MvaI CCWGG 2 cut(s) 155, 321
NdeII GATC 1 cut(s) 294
NlaIII CATG 3 cut(s) 264, 335, 429
NlaIV GGNNCC 2 cut(s) 60, 144
NspI RCATGY 1 cut(s) 264
NspV TTCGAA 1 cut(s) 169
PaeI GCATGC 1 cut(s) 264
PciSI GCTCTTC 1 cut(s) 195
PdmI GAANNNNTTC 1 cut(s) 231
PfeI GAWTC 1 cut(s) 32
PfoI TCCNGGA 1 cut(s) 319
PshAI GACNNNNGTC 1 cut(s) 352
Psp6I CCWGG 2 cut(s) 153, 319
PspGI CCWGG 2 cut(s) 153, 319
PspN4I GGNNCC 2 cut(s) 60, 144
PspPI GGNCC 1 cut(s) 142
PstI CTGCAG 1 cut(s) 97
SapI GCTCTTC 1 cut(s) 195
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 1 cut(s) 294
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 2 cut(s) 155, 321
SetI ASST 3 cut(s) 25, 292, 414
SfcI CTRYAG 1 cut(s) 93
SfuI TTCGAA 1 cut(s) 169
SphI GCATGC 1 cut(s) 264
Sse9I AATT 5 cut(s) 106, 116, 171, 270, 342
SspI AATATT 1 cut(s) 69
SspMI CTAG 3 cut(s) 39, 386, 407
StyD4I CCNGG 2 cut(s) 153, 319
TaiI ACGT 1 cut(s) 414
TaqI TCGA 3 cut(s) 169, 237, 346
TasI AATT 5 cut(s) 106, 116, 171, 270, 342
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TspDTI ATGAA 4 cut(s) 42, 116, 118, 213
XagI CCTNNNNNAGG 1 cut(s) 389
XapI RAATTY 4 cut(s) 106, 116, 171, 270
XbaI TCTAGA 1 cut(s) 38
XceI RCATGY 1 cut(s) 264
XmnI GAANNNNTTC 1 cut(s) 231
XspI CTAG 3 cut(s) 39, 386, 407
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.