Rmu_sc0002449.1_g000030

Zinc finger C-x8-C-x5-C-x3-H type (and similar)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002449.1
Physical Location & Seq
Reverse (-)
108769 .. 111498
2730 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002449.1_g000030.1.cds

Sequence Viewer

Length: 483 bp
atggaacagcacttgcgaggttctcagtcgccgatcgacgtcttcaagtaccgccgtcgtcaactgtcgccgctcgcgcccctgcagaatctgatcgcgccgcagccgggtgacggcgtttcgatgtgcaagtctacaactagctcaggattatgcacacccagcccaaagtcccacgtcgcccatcaggtcatggcgtcagctgttacagaagcagcagcagcagcgttaacctcatcgccaaagccaaagaacaccagtgagaccccaattactgtcatcagctgcaaggactggtcaccccaagatgatggcattgaggttatcttgcctccaactgaatcacaggttatcttgcctccaactgaattaccttcatcgaacgaagatgtggatgcatccagcactgctgggctgagtcttgtctatggtcctactacaactaggagattgccactgtttactgaaatttgcccagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

160

Amino Acids

17.01

Weight (kDa)

5.34

Isoelectric Point (pI)

80.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 42
AccBSI CCGCTC 1 cut(s) 73
AccI GTMKAC 1 cut(s) 134
AccII CGCG 2 cut(s) 77, 98
AciI CCGC 3 cut(s) 52, 71, 101
AcsI RAATTY 1 cut(s) 468
AcyI GRCGYC 2 cut(s) 39, 197
AfaI GTAC 1 cut(s) 50
AfiI CCNNNNNNNGG 2 cut(s) 107, 113
AgsI TTSAA 1 cut(s) 46
AjiI CACGTC 1 cut(s) 178
AluBI AGCT 3 cut(s) 144, 203, 285
AluI AGCT 3 cut(s) 144, 203, 285
Alw26I GTCTC 1 cut(s) 257
AlwNI CAGNNNCTG 1 cut(s) 91
ApeKI GCWGC 6 cut(s) 103, 215, 218, 221, 224, 285
ApoI RAATTY 1 cut(s) 468
AspLEI GCGC 2 cut(s) 79, 100
AspS9I GGNCC 1 cut(s) 431
AsuC2I CCSGG 1 cut(s) 108
AsuHPI GGTGA 2 cut(s) 122, 291
AvaII GGWCC 1 cut(s) 431
BbsI GAAGAC 1 cut(s) 34
BbvI GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
BccI CCATC 2 cut(s) 192, 305
BceAI ACGGC 2 cut(s) 39, 130
BcnI CCSGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 257
BfaI CTAG 2 cut(s) 141, 444
BfmI CTRYAG 1 cut(s) 83
BisI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
BlsI GCNGC 8 cut(s) 72, 102, 105, 217, 220, 223, 226, 287
Bme1390I CCNGG 1 cut(s) 108
Bme18I GGWCC 1 cut(s) 431
BmgBI CACGTC 1 cut(s) 178
BmgT120I GGNCC 1 cut(s) 431
BmrFI CCNGG 1 cut(s) 108
BmsI GCATC 2 cut(s) 385, 407
BpiI GAAGAC 1 cut(s) 34
Bpu10I CCTNAGC 1 cut(s) 145
BpuMI CCSGG 1 cut(s) 108
BsaHI GRCGYC 2 cut(s) 39, 197
BsaI GGTCTC 1 cut(s) 257
Bsc4I CCNNNNNNNGG 2 cut(s) 107, 113
Bse1I ACTGG 2 cut(s) 258, 299
BseGI GGATG 2 cut(s) 398, 400
BseLI CCNNNNNNNGG 2 cut(s) 107, 113
BseMII CTCAG 3 cut(s) 38, 159, 407
BseNI ACTGG 2 cut(s) 258, 299
BseXI GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
BseYI CCCAGC 2 cut(s) 161, 410
Bsh1236I CGCG 2 cut(s) 77, 98
Bsh1285I CGRYCG 1 cut(s) 36
BsiEI CGRYCG 1 cut(s) 36
BsiSI CCGG 1 cut(s) 107
BslFI GGGAC 1 cut(s) 157
BslI CCNNNNNNNGG 2 cut(s) 107, 113
BsmAI GTCTC 1 cut(s) 257
BsmFI GGGAC 1 cut(s) 157
Bso31I GGTCTC 1 cut(s) 257
Bsp143I GATC 2 cut(s) 33, 93
BspACI CCGC 3 cut(s) 52, 71, 101
BspCNI CTCAG 3 cut(s) 37, 158, 408
BspFNI CGCG 2 cut(s) 77, 98
BspMAI CTGCAG 1 cut(s) 87
BspTNI GGTCTC 1 cut(s) 257
BsrBI CCGCTC 1 cut(s) 73
BsrI ACTGG 2 cut(s) 258, 299
BssMI GATC 2 cut(s) 33, 93
BssNI GRCGYC 2 cut(s) 39, 197
Bst4CI ACNGT 3 cut(s) 66, 277, 459
BstACI GRCGYC 2 cut(s) 39, 197
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 3 cut(s) 24, 145, 416
BstEII GGTNACC 1 cut(s) 297
BstF5I GGATG 2 cut(s) 398, 400
BstFNI CGCG 2 cut(s) 77, 98
BstHHI GCGC 2 cut(s) 79, 100
BstKTI GATC 2 cut(s) 36, 96
BstMAI GTCTC 1 cut(s) 257
BstMBI GATC 2 cut(s) 33, 93
BstMCI CGRYCG 1 cut(s) 36
BstMWI GCNNNNNNNGC 4 cut(s) 76, 162, 221, 224
BstPI GGTNACC 1 cut(s) 297
BstSCI CCNGG 1 cut(s) 106
BstSFI CTRYAG 1 cut(s) 83
BstUI CGCG 2 cut(s) 77, 98
BstV1I GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
BstV2I GAAGAC 1 cut(s) 34
BstXI CCANNNNNNTGG 1 cut(s) 311
BtgZI GCGATG 1 cut(s) 222
BtrI CACGTC 1 cut(s) 178
BtsCI GGATG 2 cut(s) 398, 400
BtsI GCAGTG 1 cut(s) 405
BtsIMutI CAGTG 3 cut(s) 265, 405, 455
Cac8I GCNNGC 1 cut(s) 75
CaiI CAGNNNCTG 1 cut(s) 91
CfoI GCGC 2 cut(s) 79, 100
Cfr13I GGNCC 1 cut(s) 431
CseI GACGC 1 cut(s) 186
Csp6I GTAC 1 cut(s) 49
CviAII CATG 1 cut(s) 193
CviJI RGCY 7 cut(s) 106, 144, 165, 203, 247, 285, 415
CviKI_1 RGCY 7 cut(s) 106, 144, 165, 203, 247, 285, 415
CviQI GTAC 1 cut(s) 49
DdeI CTNAG 3 cut(s) 24, 145, 416
DpnI GATC 2 cut(s) 35, 95
DpnII GATC 2 cut(s) 33, 93
Eco31I GGTCTC 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 431
Eco91I GGTNACC 1 cut(s) 297
EcoO65I GGTNACC 1 cut(s) 297
EcoT22I ATGCAT 1 cut(s) 400
FaeI CATG 1 cut(s) 196
FaiI YATR 3 cut(s) 154, 194, 429
FaqI GGGAC 1 cut(s) 157
FatI CATG 1 cut(s) 192
FblI GTMKAC 1 cut(s) 134
Fnu4HI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
FokI GGATG 2 cut(s) 385, 407
Fsp4HI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
FspBI CTAG 2 cut(s) 141, 444
GlaI GCGC 2 cut(s) 78, 99
GluI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
GsaI CCCAGC 2 cut(s) 165, 414
HapII CCGG 1 cut(s) 107
HgaI GACGC 1 cut(s) 186
HhaI GCGC 2 cut(s) 79, 100
Hin1I GRCGYC 2 cut(s) 39, 197
Hin1II CATG 1 cut(s) 196
Hin6I GCGC 2 cut(s) 77, 98
HinP1I GCGC 2 cut(s) 77, 98
HincII GTYRAC 2 cut(s) 62, 231
HindII GTYRAC 2 cut(s) 62, 231
HinfI GANTC 3 cut(s) 88, 341, 418
HpaI GTTAAC 1 cut(s) 231
HpaII CCGG 1 cut(s) 107
HphI GGTGA 2 cut(s) 122, 291
Hpy166II GTNNAC 4 cut(s) 62, 135, 231, 462
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 147
Hpy8I GTNNAC 4 cut(s) 62, 135, 231, 462
Hpy99I CGWCG 3 cut(s) 41, 60, 182
HpyAV CCTTC 1 cut(s) 384
HpyCH4III ACNGT 3 cut(s) 66, 277, 459
HpyCH4IV ACGT 2 cut(s) 39, 177
HpyCH4V TGCA 5 cut(s) 85, 129, 156, 288, 398
HpyF10VI GCNNNNNNNGC 4 cut(s) 76, 162, 221, 224
HpyF3I CTNAG 3 cut(s) 24, 145, 416
HpySE526I ACGT 2 cut(s) 39, 177
Hsp92I GRCGYC 2 cut(s) 39, 197
Hsp92II CATG 1 cut(s) 196
HspAI GCGC 2 cut(s) 77, 98
KspAI GTTAAC 1 cut(s) 231
Kzo9I GATC 2 cut(s) 33, 93
Lsp1109I GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
LweI GCATC 2 cut(s) 385, 407
MaeI CTAG 2 cut(s) 141, 444
MaeII ACGT 2 cut(s) 39, 177
MaeIII GTNAC 3 cut(s) 110, 205, 297
MalI GATC 2 cut(s) 35, 95
MbiI CCGCTC 1 cut(s) 73
MboI GATC 2 cut(s) 33, 93
MboII GAAGA 2 cut(s) 34, 398
MluCI AATT 3 cut(s) 270, 368, 468
MlyI GAGTC 1 cut(s) 427
MmeI TCCRAC 2 cut(s) 359, 386
MnlI CCTC 5 cut(s) 11, 244, 313, 342, 369
Mph1103I ATGCAT 1 cut(s) 400
MseI TTAA 1 cut(s) 230
MspA1I CMGCKG 2 cut(s) 203, 285
MspI CCGG 1 cut(s) 107
MspR9I CCNGG 1 cut(s) 108
MvnI CGCG 2 cut(s) 77, 98
MwoI GCNNNNNNNGC 4 cut(s) 76, 162, 221, 224
NciI CCSGG 1 cut(s) 108
NdeII GATC 2 cut(s) 33, 93
NlaIII CATG 1 cut(s) 196
NmuCI GTSAC 2 cut(s) 110, 297
NsiI ATGCAT 1 cut(s) 400
PfeI GAWTC 2 cut(s) 88, 341
PkrI GCNGC 8 cut(s) 72, 102, 105, 217, 220, 223, 226, 287
Ple19I CGATCG 1 cut(s) 36
PleI GAGTC 1 cut(s) 426
PpsI GAGTC 1 cut(s) 426
PspEI GGTNACC 1 cut(s) 297
PspFI CCCAGC 2 cut(s) 161, 410
PspPI GGNCC 1 cut(s) 431
PstI CTGCAG 1 cut(s) 87
PstNI CAGNNNCTG 1 cut(s) 91
PvuI CGATCG 1 cut(s) 36
PvuII CAGCTG 2 cut(s) 203, 285
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
SaqAI TTAA 1 cut(s) 230
SatI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
Sau3AI GATC 2 cut(s) 33, 93
Sau96I GGNCC 1 cut(s) 431
SchI GAGTC 1 cut(s) 427
ScrFI CCNGG 1 cut(s) 108
SfaNI GCATC 2 cut(s) 385, 407
SfcI CTRYAG 1 cut(s) 83
SinI GGWCC 1 cut(s) 431
Sse9I AATT 3 cut(s) 270, 368, 468
SsiI CCGC 3 cut(s) 52, 71, 101
SspMI CTAG 2 cut(s) 141, 444
StyD4I CCNGG 1 cut(s) 106
TaaI ACNGT 3 cut(s) 66, 277, 459
TaiI ACGT 2 cut(s) 42, 180
TaqI TCGA 3 cut(s) 36, 122, 380
TasI AATT 3 cut(s) 270, 368, 468
TauI GCSGC 2 cut(s) 73, 103
TfiI GAWTC 2 cut(s) 88, 341
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TscAI CASTG 3 cut(s) 265, 412, 462
TseFI GTSAC 2 cut(s) 110, 297
TseI GCWGC 6 cut(s) 103, 215, 218, 221, 224, 285
Tsp45I GTSAC 2 cut(s) 110, 297
TspDTI ATGAA 1 cut(s) 366
TspRI CASTG 3 cut(s) 265, 412, 462
VpaK11BI GGWCC 1 cut(s) 431
XapI RAATTY 1 cut(s) 468
XmiI GTMKAC 1 cut(s) 134
XspI CTAG 2 cut(s) 141, 444
ZraI GACGTC 1 cut(s) 40
Zsp2I ATGCAT 1 cut(s) 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.