Rmu_sc0002905.1_g000002

Zinc finger C-x8-C-x5-C-x3-H type (and similar)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002905.1
Physical Location & Seq
Reverse (-)
3643 .. 6577
2935 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002905.1_g000002.1.cds

Sequence Viewer

Length: 558 bp
atggaacagcacttgcgaggttctcagtcgccgatcgacgtcttcaagtaccgccgtcgtcaactgtcgccgcttgcgcccctgcagaatctgatcgcgccccagccgggtcacggcgtttcggttgccggaagctacggctccaaaggccagtttgtgcatggtaaagaaaatctgcgtccaacttctttccctgccaagaacaaatccgaggcacagatgtgcaagtctacaactagctcaggattatgcacacccagcccaaagtcccacgtcgcccatcaggtcatggtgtcagctgttacagaagcagcagcagcagcagcagcgttaacctcatcgccaaagccaaagaacaccagtgagaccccaattactgtcatcagctgcaaggactggtcaccccaagatgatggcattgaggttatcttgcctccaactgaattaccttcatcgaacgaagatgtggatgcatccagcactgctgggctgagtcttgtctatggtcctactacaagaaggagattgccactgtttactgaaatttgcccagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

185

Amino Acids

19.69

Weight (kDa)

8.37

Isoelectric Point (pI)

71.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 42
AccI GTMKAC 1 cut(s) 230
AccII CGCG 1 cut(s) 98
AciI CCGC 2 cut(s) 52, 71
AcsI RAATTY 1 cut(s) 543
AcyI GRCGYC 1 cut(s) 39
AfaI GTAC 1 cut(s) 50
AfiI CCNNNNNNNGG 2 cut(s) 107, 113
AgsI TTSAA 1 cut(s) 46
AjiI CACGTC 1 cut(s) 274
AleI CACNNNNGTG 1 cut(s) 220
AluBI AGCT 4 cut(s) 135, 240, 299, 387
AluI AGCT 4 cut(s) 135, 240, 299, 387
Alw26I GTCTC 1 cut(s) 359
AlwNI CAGNNNCTG 1 cut(s) 91
AoxI GGCC 1 cut(s) 148
ApeKI GCWGC 7 cut(s) 311, 314, 317, 320, 323, 326, 387
ApoI RAATTY 1 cut(s) 543
AspLEI GCGC 2 cut(s) 79, 100
AspS9I GGNCC 1 cut(s) 506
AsuC2I CCSGG 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 393
AvaII GGWCC 1 cut(s) 506
BbsI GAAGAC 1 cut(s) 34
BbvI GCAGC 7 cut(s) 323, 326, 329, 332, 335, 338, 374
BccI CCATC 2 cut(s) 288, 407
BceAI ACGGC 3 cut(s) 39, 130, 154
BcnI CCSGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 359
BfaI CTAG 1 cut(s) 237
BfmI CTRYAG 1 cut(s) 83
BisI GCNGC 8 cut(s) 71, 312, 315, 318, 321, 324, 327, 388
BlsI GCNGC 8 cut(s) 72, 313, 316, 319, 322, 325, 328, 389
Bme1390I CCNGG 1 cut(s) 108
Bme18I GGWCC 1 cut(s) 506
BmgBI CACGTC 1 cut(s) 274
BmgT120I GGNCC 1 cut(s) 506
BmiI GGNNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 108
BmsI GCATC 2 cut(s) 460, 482
BpiI GAAGAC 1 cut(s) 34
Bpu10I CCTNAGC 1 cut(s) 241
BpuMI CCSGG 1 cut(s) 108
BsaHI GRCGYC 1 cut(s) 39
BsaI GGTCTC 1 cut(s) 359
BsaJI CCNNGG 1 cut(s) 210
Bsc4I CCNNNNNNNGG 2 cut(s) 107, 113
Bse1I ACTGG 3 cut(s) 151, 360, 401
BseDI CCNNGG 1 cut(s) 210
BseGI GGATG 2 cut(s) 473, 475
BseLI CCNNNNNNNGG 2 cut(s) 107, 113
BseMII CTCAG 3 cut(s) 38, 255, 482
BseNI ACTGG 3 cut(s) 151, 360, 401
BseXI GCAGC 7 cut(s) 323, 326, 329, 332, 335, 338, 374
BseYI CCCAGC 3 cut(s) 102, 257, 485
Bsh1236I CGCG 1 cut(s) 98
Bsh1285I CGRYCG 1 cut(s) 36
BshFI GGCC 1 cut(s) 150
BsiEI CGRYCG 1 cut(s) 36
BsiSI CCGG 2 cut(s) 107, 129
BslFI GGGAC 1 cut(s) 253
BslI CCNNNNNNNGG 2 cut(s) 107, 113
BsmAI GTCTC 1 cut(s) 359
BsmFI GGGAC 1 cut(s) 253
BsnI GGCC 1 cut(s) 150
Bso31I GGTCTC 1 cut(s) 359
Bsp143I GATC 2 cut(s) 33, 93
BspACI CCGC 2 cut(s) 52, 71
BspANI GGCC 1 cut(s) 150
BspCNI CTCAG 3 cut(s) 37, 254, 483
BspFNI CGCG 1 cut(s) 98
BspLI GGNNCC 1 cut(s) 142
BspMAI CTGCAG 1 cut(s) 87
BspTNI GGTCTC 1 cut(s) 359
BsrI ACTGG 3 cut(s) 151, 360, 401
BssECI CCNNGG 1 cut(s) 210
BssMI GATC 2 cut(s) 33, 93
BssNI GRCGYC 1 cut(s) 39
Bst4CI ACNGT 3 cut(s) 66, 379, 534
BstACI GRCGYC 1 cut(s) 39
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 3 cut(s) 24, 241, 491
BstEII GGTNACC 1 cut(s) 399
BstF5I GGATG 2 cut(s) 473, 475
BstFNI CGCG 1 cut(s) 98
BstHHI GCGC 2 cut(s) 79, 100
BstKTI GATC 2 cut(s) 36, 96
BstMAI GTCTC 1 cut(s) 359
BstMBI GATC 2 cut(s) 33, 93
BstMCI CGRYCG 1 cut(s) 36
BstMWI GCNNNNNNNGC 7 cut(s) 76, 147, 258, 317, 320, 323, 326
BstPI GGTNACC 1 cut(s) 399
BstSCI CCNGG 1 cut(s) 106
BstSFI CTRYAG 1 cut(s) 83
BstUI CGCG 1 cut(s) 98
BstV1I GCAGC 7 cut(s) 323, 326, 329, 332, 335, 338, 374
BstV2I GAAGAC 1 cut(s) 34
BstXI CCANNNNNNTGG 1 cut(s) 413
BsuRI GGCC 1 cut(s) 150
BtgZI GCGATG 1 cut(s) 324
BtrI CACGTC 1 cut(s) 274
BtsCI GGATG 2 cut(s) 473, 475
BtsI GCAGTG 1 cut(s) 480
BtsIMutI CAGTG 3 cut(s) 367, 480, 530
Cac8I GCNNGC 1 cut(s) 75
CaiI CAGNNNCTG 1 cut(s) 91
CfoI GCGC 2 cut(s) 79, 100
Cfr13I GGNCC 1 cut(s) 506
CseI GACGC 1 cut(s) 167
Csp6I GTAC 1 cut(s) 49
CviAII CATG 2 cut(s) 161, 289
CviQI GTAC 1 cut(s) 49
DdeI CTNAG 3 cut(s) 24, 241, 491
DpnI GATC 2 cut(s) 35, 95
DpnII GATC 2 cut(s) 33, 93
Eco31I GGTCTC 1 cut(s) 359
Eco47I GGWCC 1 cut(s) 506
Eco91I GGTNACC 1 cut(s) 399
EcoO65I GGTNACC 1 cut(s) 399
EcoT22I ATGCAT 1 cut(s) 475
FaeI CATG 2 cut(s) 164, 292
FaiI YATR 4 cut(s) 162, 250, 290, 504
FaqI GGGAC 1 cut(s) 253
FatI CATG 2 cut(s) 160, 288
FblI GTMKAC 1 cut(s) 230
Fnu4HI GCNGC 8 cut(s) 71, 312, 315, 318, 321, 324, 327, 388
FokI GGATG 2 cut(s) 460, 482
Fsp4HI GCNGC 8 cut(s) 71, 312, 315, 318, 321, 324, 327, 388
FspBI CTAG 1 cut(s) 237
GlaI GCGC 2 cut(s) 78, 99
GluI GCNGC 8 cut(s) 71, 312, 315, 318, 321, 324, 327, 388
GsaI CCCAGC 3 cut(s) 106, 261, 489
HaeIII GGCC 1 cut(s) 150
HapII CCGG 2 cut(s) 107, 129
HgaI GACGC 1 cut(s) 167
HhaI GCGC 2 cut(s) 79, 100
Hin1I GRCGYC 1 cut(s) 39
Hin1II CATG 2 cut(s) 164, 292
Hin6I GCGC 2 cut(s) 77, 98
HinP1I GCGC 2 cut(s) 77, 98
HincII GTYRAC 2 cut(s) 62, 333
HindII GTYRAC 2 cut(s) 62, 333
HinfI GANTC 2 cut(s) 88, 493
HpaI GTTAAC 1 cut(s) 333
HpaII CCGG 2 cut(s) 107, 129
HphI GGTGA 1 cut(s) 393
Hpy166II GTNNAC 4 cut(s) 62, 231, 333, 537
Hpy188I TCNGA 2 cut(s) 93, 211
Hpy188III TCNNGA 1 cut(s) 243
Hpy8I GTNNAC 4 cut(s) 62, 231, 333, 537
Hpy99I CGWCG 3 cut(s) 41, 60, 278
HpyAV CCTTC 2 cut(s) 459, 513
HpyCH4III ACNGT 3 cut(s) 66, 379, 534
HpyCH4IV ACGT 2 cut(s) 39, 273
HpyCH4V TGCA 6 cut(s) 85, 160, 225, 252, 390, 473
HpyF10VI GCNNNNNNNGC 7 cut(s) 76, 147, 258, 317, 320, 323, 326
HpyF3I CTNAG 3 cut(s) 24, 241, 491
HpySE526I ACGT 2 cut(s) 39, 273
Hsp92I GRCGYC 1 cut(s) 39
Hsp92II CATG 2 cut(s) 164, 292
HspAI GCGC 2 cut(s) 77, 98
KspAI GTTAAC 1 cut(s) 333
Kzo9I GATC 2 cut(s) 33, 93
LmnI GCTCC 1 cut(s) 146
Lsp1109I GCAGC 7 cut(s) 323, 326, 329, 332, 335, 338, 374
LweI GCATC 2 cut(s) 460, 482
MaeI CTAG 1 cut(s) 237
MaeII ACGT 2 cut(s) 39, 273
MaeIII GTNAC 3 cut(s) 110, 301, 399
MalI GATC 2 cut(s) 35, 95
MboI GATC 2 cut(s) 33, 93
MboII GAAGA 2 cut(s) 34, 473
MluCI AATT 3 cut(s) 372, 443, 543
MlyI GAGTC 1 cut(s) 502
MmeI TCCRAC 2 cut(s) 206, 461
MnlI CCTC 5 cut(s) 11, 205, 346, 415, 444
Mph1103I ATGCAT 1 cut(s) 475
MseI TTAA 1 cut(s) 332
MslI CAYNNNNRTG 1 cut(s) 220
MspA1I CMGCKG 2 cut(s) 299, 387
MspI CCGG 2 cut(s) 107, 129
MspR9I CCNGG 1 cut(s) 108
MvnI CGCG 1 cut(s) 98
MwoI GCNNNNNNNGC 7 cut(s) 76, 147, 258, 317, 320, 323, 326
NciI CCSGG 1 cut(s) 108
NdeII GATC 2 cut(s) 33, 93
NlaIII CATG 2 cut(s) 164, 292
NlaIV GGNNCC 1 cut(s) 142
NmuCI GTSAC 2 cut(s) 110, 399
NsiI ATGCAT 1 cut(s) 475
OliI CACNNNNGTG 1 cut(s) 220
PfeI GAWTC 1 cut(s) 88
PkrI GCNGC 8 cut(s) 72, 313, 316, 319, 322, 325, 328, 389
Ple19I CGATCG 1 cut(s) 36
PleI GAGTC 1 cut(s) 501
PpsI GAGTC 1 cut(s) 501
PspEI GGTNACC 1 cut(s) 399
PspFI CCCAGC 3 cut(s) 102, 257, 485
PspN4I GGNNCC 1 cut(s) 142
PspPI GGNCC 1 cut(s) 506
PstI CTGCAG 1 cut(s) 87
PstNI CAGNNNCTG 1 cut(s) 91
PvuI CGATCG 1 cut(s) 36
PvuII CAGCTG 2 cut(s) 299, 387
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 220
SaqAI TTAA 1 cut(s) 332
SatI GCNGC 8 cut(s) 71, 312, 315, 318, 321, 324, 327, 388
Sau3AI GATC 2 cut(s) 33, 93
Sau96I GGNCC 1 cut(s) 506
SchI GAGTC 1 cut(s) 502
ScrFI CCNGG 1 cut(s) 108
SfaNI GCATC 2 cut(s) 460, 482
SfcI CTRYAG 1 cut(s) 83
SinI GGWCC 1 cut(s) 506
SmiMI CAYNNNNRTG 1 cut(s) 220
Sse9I AATT 3 cut(s) 372, 443, 543
SsiI CCGC 2 cut(s) 52, 71
SspMI CTAG 1 cut(s) 237
StyD4I CCNGG 1 cut(s) 106
TaaI ACNGT 3 cut(s) 66, 379, 534
TaiI ACGT 2 cut(s) 42, 276
TaqI TCGA 2 cut(s) 36, 455
TasI AATT 3 cut(s) 372, 443, 543
TauI GCSGC 1 cut(s) 73
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 332
Tru9I TTAA 1 cut(s) 332
TscAI CASTG 3 cut(s) 367, 487, 537
TseFI GTSAC 2 cut(s) 110, 399
TseI GCWGC 7 cut(s) 311, 314, 317, 320, 323, 326, 387
Tsp45I GTSAC 2 cut(s) 110, 399
TspDTI ATGAA 1 cut(s) 441
TspRI CASTG 3 cut(s) 367, 487, 537
VpaK11BI GGWCC 1 cut(s) 506
XapI RAATTY 1 cut(s) 543
XcmI CCANNNNNNNNNTGG 1 cut(s) 158
XmiI GTMKAC 1 cut(s) 230
XspI CTAG 1 cut(s) 237
ZraI GACGTC 1 cut(s) 40
Zsp2I ATGCAT 1 cut(s) 475
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.