Rmu_sc0003720.1_g000007

Zinc finger C-x8-C-x5-C-x3-H type (and similar)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003720.1
Physical Location & Seq
Forward (+)
47910 .. 50640
2731 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003720.1_g000007.1.cds

Sequence Viewer

Length: 456 bp
atggaacagcacttgcgaggttctcagtcgccgatcgacgtcttcaagtaccgccgtcgtcaactgtcgccgctcgcgcccctgcagaatctgatcgcgccgcagccgggtgacggcgtttcgatgtgcaagtctacaactagctcaggattatgcacacccagcccaaagtcccacgtcgcccatcaggtcatgtcgtcagctgttacagaagcagcagcagcagcgttaacctcatcgccaaagccaaataacaccagcgagaccccaattactgtcatcagctgcaaggactggtcaccccaagatgatggcattgaggttatcttgcctccaactgaattaccttcatcgaacgaagatgtggatgcatccagcactgctgggctgagtcttgtctatggtcctactacaacaaggagattgccactgtttactgaaatttgcccagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

151

Amino Acids

16.04

Weight (kDa)

5.31

Isoelectric Point (pI)

81.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 42
AccBSI CCGCTC 1 cut(s) 73
AccI GTMKAC 1 cut(s) 134
AccII CGCG 2 cut(s) 77, 98
AciI CCGC 3 cut(s) 52, 71, 101
AcsI RAATTY 1 cut(s) 441
AcyI GRCGYC 1 cut(s) 39
AfaI GTAC 1 cut(s) 50
AfiI CCNNNNNNNGG 2 cut(s) 107, 113
AgsI TTSAA 1 cut(s) 46
AjiI CACGTC 1 cut(s) 178
AluBI AGCT 3 cut(s) 144, 203, 285
AluI AGCT 3 cut(s) 144, 203, 285
Alw26I GTCTC 1 cut(s) 257
AlwNI CAGNNNCTG 1 cut(s) 91
ApeKI GCWGC 6 cut(s) 103, 215, 218, 221, 224, 285
ApoI RAATTY 1 cut(s) 441
AspLEI GCGC 2 cut(s) 79, 100
AspS9I GGNCC 1 cut(s) 404
AsuC2I CCSGG 1 cut(s) 108
AsuHPI GGTGA 2 cut(s) 122, 291
AvaII GGWCC 1 cut(s) 404
BbsI GAAGAC 1 cut(s) 34
BbvI GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
BccI CCATC 2 cut(s) 192, 305
BceAI ACGGC 2 cut(s) 39, 130
BcnI CCSGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 257
BfaI CTAG 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 83
BisI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
BlsI GCNGC 8 cut(s) 72, 102, 105, 217, 220, 223, 226, 287
Bme1390I CCNGG 1 cut(s) 108
Bme18I GGWCC 1 cut(s) 404
BmgBI CACGTC 1 cut(s) 178
BmgT120I GGNCC 1 cut(s) 404
BmrFI CCNGG 1 cut(s) 108
BmsI GCATC 2 cut(s) 358, 380
BpiI GAAGAC 1 cut(s) 34
Bpu10I CCTNAGC 1 cut(s) 145
BpuMI CCSGG 1 cut(s) 108
BsaHI GRCGYC 1 cut(s) 39
BsaI GGTCTC 1 cut(s) 257
Bsc4I CCNNNNNNNGG 2 cut(s) 107, 113
Bse1I ACTGG 1 cut(s) 299
BseGI GGATG 2 cut(s) 371, 373
BseLI CCNNNNNNNGG 2 cut(s) 107, 113
BseMII CTCAG 3 cut(s) 38, 159, 380
BseNI ACTGG 1 cut(s) 299
BseXI GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
BseYI CCCAGC 2 cut(s) 161, 383
Bsh1236I CGCG 2 cut(s) 77, 98
Bsh1285I CGRYCG 1 cut(s) 36
BsiEI CGRYCG 1 cut(s) 36
BsiSI CCGG 1 cut(s) 107
BslFI GGGAC 1 cut(s) 157
BslI CCNNNNNNNGG 2 cut(s) 107, 113
BsmAI GTCTC 1 cut(s) 257
BsmFI GGGAC 1 cut(s) 157
Bso31I GGTCTC 1 cut(s) 257
Bsp143I GATC 2 cut(s) 33, 93
BspACI CCGC 3 cut(s) 52, 71, 101
BspCNI CTCAG 3 cut(s) 37, 158, 381
BspFNI CGCG 2 cut(s) 77, 98
BspMAI CTGCAG 1 cut(s) 87
BspTNI GGTCTC 1 cut(s) 257
BsrBI CCGCTC 1 cut(s) 73
BsrI ACTGG 1 cut(s) 299
BssMI GATC 2 cut(s) 33, 93
BssNI GRCGYC 1 cut(s) 39
Bst4CI ACNGT 3 cut(s) 66, 277, 432
BstACI GRCGYC 1 cut(s) 39
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 3 cut(s) 24, 145, 389
BstEII GGTNACC 1 cut(s) 297
BstF5I GGATG 2 cut(s) 371, 373
BstFNI CGCG 2 cut(s) 77, 98
BstHHI GCGC 2 cut(s) 79, 100
BstKTI GATC 2 cut(s) 36, 96
BstMAI GTCTC 1 cut(s) 257
BstMBI GATC 2 cut(s) 33, 93
BstMCI CGRYCG 1 cut(s) 36
BstMWI GCNNNNNNNGC 4 cut(s) 76, 162, 221, 224
BstPI GGTNACC 1 cut(s) 297
BstSCI CCNGG 1 cut(s) 106
BstSFI CTRYAG 1 cut(s) 83
BstUI CGCG 2 cut(s) 77, 98
BstV1I GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
BstV2I GAAGAC 1 cut(s) 34
BstXI CCANNNNNNTGG 1 cut(s) 311
BtgZI GCGATG 1 cut(s) 222
BtrI CACGTC 1 cut(s) 178
BtsCI GGATG 2 cut(s) 371, 373
BtsI GCAGTG 1 cut(s) 378
BtsIMutI CAGTG 2 cut(s) 378, 428
Cac8I GCNNGC 1 cut(s) 75
CaiI CAGNNNCTG 1 cut(s) 91
CfoI GCGC 2 cut(s) 79, 100
Cfr13I GGNCC 1 cut(s) 404
Csp6I GTAC 1 cut(s) 49
CviAII CATG 1 cut(s) 193
CviJI RGCY 7 cut(s) 106, 144, 165, 203, 247, 285, 388
CviKI_1 RGCY 7 cut(s) 106, 144, 165, 203, 247, 285, 388
CviQI GTAC 1 cut(s) 49
DdeI CTNAG 3 cut(s) 24, 145, 389
DpnI GATC 2 cut(s) 35, 95
DpnII GATC 2 cut(s) 33, 93
Eco31I GGTCTC 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 404
Eco91I GGTNACC 1 cut(s) 297
EcoO65I GGTNACC 1 cut(s) 297
EcoT22I ATGCAT 1 cut(s) 373
FaeI CATG 1 cut(s) 196
FaiI YATR 3 cut(s) 154, 194, 402
FaqI GGGAC 1 cut(s) 157
FatI CATG 1 cut(s) 192
FblI GTMKAC 1 cut(s) 134
Fnu4HI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
FokI GGATG 2 cut(s) 358, 380
Fsp4HI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
FspBI CTAG 1 cut(s) 141
GlaI GCGC 2 cut(s) 78, 99
GluI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
GsaI CCCAGC 2 cut(s) 165, 387
HapII CCGG 1 cut(s) 107
HhaI GCGC 2 cut(s) 79, 100
Hin1I GRCGYC 1 cut(s) 39
Hin1II CATG 1 cut(s) 196
Hin6I GCGC 2 cut(s) 77, 98
HinP1I GCGC 2 cut(s) 77, 98
HincII GTYRAC 2 cut(s) 62, 231
HindII GTYRAC 2 cut(s) 62, 231
HinfI GANTC 2 cut(s) 88, 391
HpaI GTTAAC 1 cut(s) 231
HpaII CCGG 1 cut(s) 107
HphI GGTGA 2 cut(s) 122, 291
Hpy166II GTNNAC 4 cut(s) 62, 135, 231, 435
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 147
Hpy8I GTNNAC 4 cut(s) 62, 135, 231, 435
Hpy99I CGWCG 3 cut(s) 41, 60, 182
HpyAV CCTTC 1 cut(s) 357
HpyCH4III ACNGT 3 cut(s) 66, 277, 432
HpyCH4IV ACGT 2 cut(s) 39, 177
HpyCH4V TGCA 5 cut(s) 85, 129, 156, 288, 371
HpyF10VI GCNNNNNNNGC 4 cut(s) 76, 162, 221, 224
HpyF3I CTNAG 3 cut(s) 24, 145, 389
HpySE526I ACGT 2 cut(s) 39, 177
Hsp92I GRCGYC 1 cut(s) 39
Hsp92II CATG 1 cut(s) 196
HspAI GCGC 2 cut(s) 77, 98
KspAI GTTAAC 1 cut(s) 231
Kzo9I GATC 2 cut(s) 33, 93
LpnPI CCDG 9 cut(s) 95, 120, 132, 173, 175, 271, 280, 369, 388
Lsp1109I GCAGC 6 cut(s) 115, 227, 230, 233, 236, 272
LweI GCATC 2 cut(s) 358, 380
MaeI CTAG 1 cut(s) 141
MaeII ACGT 2 cut(s) 39, 177
MaeIII GTNAC 3 cut(s) 110, 205, 297
MalI GATC 2 cut(s) 35, 95
MbiI CCGCTC 1 cut(s) 73
MboI GATC 2 cut(s) 33, 93
MboII GAAGA 2 cut(s) 34, 371
MluCI AATT 3 cut(s) 270, 341, 441
MlyI GAGTC 1 cut(s) 400
MmeI TCCRAC 1 cut(s) 359
MnlI CCTC 4 cut(s) 11, 244, 313, 342
Mph1103I ATGCAT 1 cut(s) 373
MseI TTAA 1 cut(s) 230
MspA1I CMGCKG 2 cut(s) 203, 285
MspI CCGG 1 cut(s) 107
MspR9I CCNGG 1 cut(s) 108
MvnI CGCG 2 cut(s) 77, 98
MwoI GCNNNNNNNGC 4 cut(s) 76, 162, 221, 224
NciI CCSGG 1 cut(s) 108
NdeII GATC 2 cut(s) 33, 93
NlaIII CATG 1 cut(s) 196
NmuCI GTSAC 2 cut(s) 110, 297
NsiI ATGCAT 1 cut(s) 373
PfeI GAWTC 1 cut(s) 88
PkrI GCNGC 8 cut(s) 72, 102, 105, 217, 220, 223, 226, 287
Ple19I CGATCG 1 cut(s) 36
PleI GAGTC 1 cut(s) 399
PpsI GAGTC 1 cut(s) 399
PspEI GGTNACC 1 cut(s) 297
PspFI CCCAGC 2 cut(s) 161, 383
PspPI GGNCC 1 cut(s) 404
PstI CTGCAG 1 cut(s) 87
PstNI CAGNNNCTG 1 cut(s) 91
PvuI CGATCG 1 cut(s) 36
PvuII CAGCTG 2 cut(s) 203, 285
RsaI GTAC 1 cut(s) 50
RsaNI GTAC 1 cut(s) 49
SaqAI TTAA 1 cut(s) 230
SatI GCNGC 8 cut(s) 71, 101, 104, 216, 219, 222, 225, 286
Sau3AI GATC 2 cut(s) 33, 93
Sau96I GGNCC 1 cut(s) 404
SchI GAGTC 1 cut(s) 400
ScrFI CCNGG 1 cut(s) 108
SfaNI GCATC 2 cut(s) 358, 380
SfcI CTRYAG 1 cut(s) 83
SinI GGWCC 1 cut(s) 404
Sse9I AATT 3 cut(s) 270, 341, 441
SsiI CCGC 3 cut(s) 52, 71, 101
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 1 cut(s) 106
TaaI ACNGT 3 cut(s) 66, 277, 432
TaiI ACGT 2 cut(s) 42, 180
TaqI TCGA 3 cut(s) 36, 122, 353
TasI AATT 3 cut(s) 270, 341, 441
TauI GCSGC 2 cut(s) 73, 103
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TscAI CASTG 2 cut(s) 385, 435
TseFI GTSAC 2 cut(s) 110, 297
TseI GCWGC 6 cut(s) 103, 215, 218, 221, 224, 285
Tsp45I GTSAC 2 cut(s) 110, 297
TspDTI ATGAA 1 cut(s) 339
TspRI CASTG 2 cut(s) 385, 435
VpaK11BI GGWCC 1 cut(s) 404
XapI RAATTY 1 cut(s) 441
XmiI GTMKAC 1 cut(s) 134
XspI CTAG 1 cut(s) 141
ZraI GACGTC 1 cut(s) 40
Zsp2I ATGCAT 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.