Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004618.1

Orthogroup ID

OG0000678

Physical Location & Seq

Genomic Coordinates Forward (+)

112696 .. 113562

Gene Structure 867 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004618.1_g000030.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

atgaagaacttctggttgttcgtctttggaagggtcttcaatgctgctgctatagtgattcaagattttgatgcagttgtgaacaaggtcttcttccatggatactcagttctcatgattctcaaccatgcattcagtggcattgctgtgtctatggtaatgaagtatgctgacaatattgtgaaggtaaaagttggcatcaaacttaatatgaagatatttaaaaggccacagcatggatcactgaccatttatcttttgcaatcaacaaagacatgctctctgttaatctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005342 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0006810 GO:0006811 GO:0006820 GO:0008150 GO:0008509 GO:0008514 GO:0012505 GO:0015075 GO:0015136 GO:0015318 GO:0015711 GO:0015739 GO:0015849 GO:0022857 GO:0031410 GO:0031982 GO:0031984 GO:0034220 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0046942 GO:0046943 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0097708 GO:0098656 GO:0098791 GO:1901264 GO:1901505 GO:1903825 GO:1905039

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Nuc_sug_transp

Protein Analysis

97

Amino Acids

11.0

Weight (kDa)

10.01

Isoelectric Point (pI)

23.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000678)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G17700 AT3G17700
fragaria_vesca	FvH4_5g18080 FvH4_5g18080 FvH4_5g18080 FvH4_6g44780
malus_domestica	MD06G1236300.v1.1 MD09G1093300.v1.1 MD14G1243200.v1.1
prunus_persica	Prupe.1G183800_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1
pyrus_communis	pycom06g21110 pycom06g21140 pycom06g21190 pycom14g20450
rosa_chinensis	RchiOBHm_Chr2g0161941 RchiOBHm_Chr4g0441651 RchiOBHm_Chr5g0083381 RchiOBHm_Chr6g0281101 RchiOBHm_Chr7g0177531
rosa_laevigata	RLG00000005528 RLG00000015203 RLG00000015445 RLG00000021309 RLG00000023742 RLG00000034422 RLG00000036136
rosa_multiflora	Rmu_co8432259.1_g000001 Rmu_co8481019.1_g000001 Rmu_sc0003410.1_g000009 Rmu_sc0004618.1_g000030 Rmu_sc0005144.1_g000007 Rmu_sc0008565.1_g000001 Rmu_sc0018381.1_g000003 Rmu_ssc0000330.1_g000004
rosa_roxburghii	Rroxscaffold_1G00051700 Rroxscaffold_2G00088450 Rroxscaffold_2G00116130 Rroxscaffold_2G00126580 Rroxscaffold_3G00275780 Rroxscaffold_5G00338690 Rroxscaffold_5G00375080
rosa_rugosa	Rorug02G0493400 Rorug04G0058900 Rorug04G0059000 Rorug06G0407100
rosa_samantha	Rh2AG220400 Rh2AG282700 Rh2AG329100 Rh2AG559300 Rh2BG572700 Rh2CG542900 Rh2DG582500 Rh4AG135300 Rh4BG096100 Rh4DG026800 Rh4DG329100 Rh5CG271500 Rh6DG096900 Rh7AG006400 Rh7BG006300 Rh7CG006800 Rh7DG006400 Rh7DG278200
rosa_wichuraiana	Rw0G014790 Rw1G017310 Rw7G000530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	236
AclWI	GGATC	1 cut(s)	247
AfiI	CCNNNNNNNGG	1 cut(s)	236
AgsI	TTSAA	2 cut(s)	40, 62
AloI	GAACNNNNNNTCC	2 cut(s)	93, 125
AlwI	GGATC	1 cut(s)	247
AoxI	GGCC	1 cut(s)	227
ApeKI	GCWGC	2 cut(s)	44, 47
Asp700I	GAANNNNTTC	1 cut(s)	8
BbsI	GAAGAC	2 cut(s)	28, 82
BbvI	GCAGC	2 cut(s)	31, 34
BciVI	GTATCC	1 cut(s)	95
BfaI	CTAG	1 cut(s)	292
BfmI	CTRYAG	1 cut(s)	51
BfuI	GTATCC	1 cut(s)	95
BisI	GCNGC	2 cut(s)	45, 48
BlsI	GCNGC	2 cut(s)	46, 49
BmsI	GCATC	2 cut(s)	61, 207
BpiI	GAAGAC	2 cut(s)	28, 82
BsaJI	CCNNGG	1 cut(s)	97
Bsc4I	CCNNNNNNNGG	1 cut(s)	236
Bse3DI	GCAATG	1 cut(s)	141
BseDI	CCNNGG	1 cut(s)	97
BseLI	CCNNNNNNNGG	1 cut(s)	236
BseMI	GCAATG	1 cut(s)	141
BseMII	CTCAG	1 cut(s)	120
BseXI	GCAGC	2 cut(s)	31, 34
BshFI	GGCC	1 cut(s)	229
BslI	CCNNNNNNNGG	1 cut(s)	236
BsmI	GAATGC	1 cut(s)	131
BsnI	GGCC	1 cut(s)	229
Bsp143I	GATC	1 cut(s)	239
Bsp19I	CCATGG	1 cut(s)	97
BspANI	GGCC	1 cut(s)	229
BspCNI	CTCAG	1 cut(s)	119
BspHI	TCATGA	1 cut(s)	114
BspPI	GGATC	1 cut(s)	247
BsrDI	GCAATG	1 cut(s)	141
BssECI	CCNNGG	1 cut(s)	97
BssMI	GATC	1 cut(s)	239
BssT1I	CCWWGG	1 cut(s)	97
BstDEI	CTNAG	1 cut(s)	106
BstDSI	CCRYGG	1 cut(s)	97
BstKTI	GATC	1 cut(s)	242
BstMBI	GATC	1 cut(s)	239
BstNSI	RCATGY	1 cut(s)	279
BstSFI	CTRYAG	1 cut(s)	51
BstV1I	GCAGC	2 cut(s)	31, 34
BstV2I	GAAGAC	2 cut(s)	28, 82
BsuI	GTATCC	1 cut(s)	95
BsuRI	GGCC	1 cut(s)	229
BtgI	CCRYGG	1 cut(s)	97
BtsIMutI	CAGTG	2 cut(s)	142, 242
CciI	TCATGA	1 cut(s)	114
CviAII	CATG	5 cut(s)	98, 115, 128, 236, 276
CviJI	RGCY	1 cut(s)	229
CviKI_1	RGCY	1 cut(s)	229
DdeI	CTNAG	1 cut(s)	106
DpnI	GATC	1 cut(s)	241
DpnII	GATC	1 cut(s)	239
DraI	TTTAAA	1 cut(s)	223
Eco130I	CCWWGG	1 cut(s)	97
EcoT14I	CCWWGG	1 cut(s)	97
EcoT22I	ATGCAT	1 cut(s)	133
ErhI	CCWWGG	1 cut(s)	97
FaeI	CATG	5 cut(s)	101, 118, 131, 239, 279
FaiI	YATR	9 cut(s)	53, 99, 116, 129, 155, 168, 212, 237, 277
FalI	AAGNNNNNCTT	2 cut(s)	77, 109
FatI	CATG	5 cut(s)	97, 114, 127, 235, 275
Fnu4HI	GCNGC	2 cut(s)	45, 48
Fsp4HI	GCNGC	2 cut(s)	45, 48
FspBI	CTAG	1 cut(s)	292
GluI	GCNGC	2 cut(s)	45, 48
HaeIII	GGCC	1 cut(s)	229
Hin1II	CATG	5 cut(s)	101, 118, 131, 239, 279
HinfI	GANTC	2 cut(s)	58, 118
Hpy166II	GTNNAC	1 cut(s)	82
Hpy188III	TCNNGA	2 cut(s)	62, 115
Hpy8I	GTNNAC	1 cut(s)	82
HpyAV	CCTTC	2 cut(s)	24, 178
HpyCH4V	TGCA	3 cut(s)	74, 131, 262
HpyF3I	CTNAG	1 cut(s)	106
Hsp92II	CATG	5 cut(s)	101, 118, 131, 239, 279
Kzo9I	GATC	1 cut(s)	239
Lsp1109I	GCAGC	2 cut(s)	31, 34
LweI	GCATC	2 cut(s)	61, 207
MaeI	CTAG	1 cut(s)	292
MalI	GATC	1 cut(s)	241
MboI	GATC	1 cut(s)	239
MboII	GAAGA	5 cut(s)	16, 28, 82, 85, 226
Mph1103I	ATGCAT	1 cut(s)	133
MroXI	GAANNNNTTC	1 cut(s)	8
MseI	TTAA	3 cut(s)	207, 222, 287
MslI	CAYNNNNRTG	1 cut(s)	146
Mva1269I	GAATGC	1 cut(s)	131
NcoI	CCATGG	1 cut(s)	97
NdeII	GATC	1 cut(s)	239
NlaIII	CATG	5 cut(s)	101, 118, 131, 239, 279
NsiI	ATGCAT	1 cut(s)	133
NspI	RCATGY	1 cut(s)	279
PagI	TCATGA	1 cut(s)	114
PctI	GAATGC	1 cut(s)	131
PdmI	GAANNNNTTC	1 cut(s)	8
PfeI	GAWTC	2 cut(s)	58, 118
PflMI	CCANNNNNTGG	1 cut(s)	236
PkrI	GCNGC	2 cut(s)	46, 49
RseI	CAYNNNNRTG	1 cut(s)	146
SaqAI	TTAA	3 cut(s)	207, 222, 287
SatI	GCNGC	2 cut(s)	45, 48
Sau3AI	GATC	1 cut(s)	239
SetI	ASST	2 cut(s)	90, 189
SfaNI	GCATC	2 cut(s)	61, 207
SfcI	CTRYAG	1 cut(s)	51
SgeI	CNNG	8 cut(s)	25, 74, 97, 110, 127, 140, 248, 288
SmiMI	CAYNNNNRTG	1 cut(s)	146
SspI	AATATT	1 cut(s)	178
SspMI	CTAG	1 cut(s)	292
StyI	CCWWGG	1 cut(s)	97
TfiI	GAWTC	2 cut(s)	58, 118
Tru1I	TTAA	3 cut(s)	207, 222, 287
Tru9I	TTAA	3 cut(s)	207, 222, 287
TscAI	CASTG	2 cut(s)	142, 249
TseI	GCWGC	2 cut(s)	44, 47
TspDTI	ATGAA	3 cut(s)	17, 176, 227
TspRI	CASTG	2 cut(s)	142, 249
Van91I	CCANNNNNTGG	1 cut(s)	236
XceI	RCATGY	1 cut(s)	279
XcmI	CCANNNNNNNNNTGG	1 cut(s)	134
XmnI	GAANNNNTTC	1 cut(s)	8
XspI	CTAG	1 cut(s)	292
Zsp2I	ATGCAT	1 cut(s)	133

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.