Rroxscaffold_2G00126580

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000678
Physical Location & Seq
Reverse (-)
61937406 .. 61940349
2944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00126580.1

Sequence Viewer

Length: 168 bp
ATGGCCTATCAAGTACGTCAAAGAGAATTAGGCATTTCGGAGGTAAAAGTCGGCATCAAGCATAATATGAAGATGTTTAAAAGGCCACAGGATGGTTCACTGGCTATATATTTATCTCGTGCAATTAACAAAGACAATAGAAATCTAAGATGCTCTCTGTTAATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.4

Weight (kDa)

10.37

Isoelectric Point (pI)

46.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000678)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G17700 AT3G17700
fragaria_vesca FvH4_5g18080 FvH4_5g18080 FvH4_5g18080 FvH4_6g44780
malus_domestica MD06G1236300.v1.1 MD09G1093300.v1.1 MD14G1243200.v1.1
prunus_persica Prupe.1G183800_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1
pyrus_communis pycom06g21110 pycom06g21140 pycom06g21190 pycom14g20450
rosa_chinensis RchiOBHm_Chr2g0161941 RchiOBHm_Chr4g0441651 RchiOBHm_Chr5g0083381 RchiOBHm_Chr6g0281101 RchiOBHm_Chr7g0177531
rosa_laevigata RLG00000005528 RLG00000015203 RLG00000015445 RLG00000021309 RLG00000023742 RLG00000034422 RLG00000036136
rosa_multiflora Rmu_co8432259.1_g000001 Rmu_co8481019.1_g000001 Rmu_sc0003410.1_g000009 Rmu_sc0004618.1_g000030 Rmu_sc0005144.1_g000007 Rmu_sc0008565.1_g000001 Rmu_sc0018381.1_g000003 Rmu_ssc0000330.1_g000004
rosa_roxburghii Rroxscaffold_1G00051700 Rroxscaffold_2G00088450 Rroxscaffold_2G00116130 Rroxscaffold_2G00126580 Rroxscaffold_3G00275780 Rroxscaffold_5G00338690 Rroxscaffold_5G00375080
rosa_rugosa Rorug02G0493400 Rorug04G0058900 Rorug04G0059000 Rorug06G0407100
rosa_samantha Rh2AG220400 Rh2AG282700 Rh2AG329100 Rh2AG559300 Rh2BG572700 Rh2CG542900 Rh2DG582500 Rh4AG135300 Rh4BG096100 Rh4DG026800 Rh4DG329100 Rh5CG271500 Rh6DG096900 Rh7AG006400 Rh7BG006300 Rh7CG006800 Rh7DG006400 Rh7DG278200
rosa_wichuraiana Rw0G014790 Rw1G017310 Rw7G000530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 92
AfaI GTAC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 92
AoxI GGCC 2 cut(s) 3, 83
BauI CACGAG 1 cut(s) 117
BccI CCATC 1 cut(s) 86
BmsI GCATC 2 cut(s) 63, 140
Bsc4I CCNNNNNNNGG 1 cut(s) 92
Bse1I ACTGG 1 cut(s) 105
BseGI GGATG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 105
BshFI GGCC 2 cut(s) 5, 85
BslI CCNNNNNNNGG 1 cut(s) 92
BsnI GGCC 2 cut(s) 5, 85
BspANI GGCC 2 cut(s) 5, 85
BsrI ACTGG 1 cut(s) 105
BssSI CACGAG 1 cut(s) 117
Bst2BI CACGAG 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 146
BstF5I GGATG 1 cut(s) 97
BsuRI GGCC 2 cut(s) 5, 85
BtsCI GGATG 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 98
Csp6I GTAC 1 cut(s) 14
CviJI RGCY 3 cut(s) 5, 85, 104
CviKI_1 RGCY 3 cut(s) 5, 85, 104
CviQI GTAC 1 cut(s) 14
DdeI CTNAG 1 cut(s) 146
DraI TTTAAA 1 cut(s) 79
FaiI YATR 4 cut(s) 63, 68, 107, 109
FokI GGATG 1 cut(s) 104
HaeIII GGCC 2 cut(s) 5, 85
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 40
Hpy8I GTNNAC 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 122
HpyF3I CTNAG 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 16
LpnPI CCDG 2 cut(s) 74, 86
LweI GCATC 2 cut(s) 63, 140
MaeII ACGT 1 cut(s) 16
MboII GAAGA 1 cut(s) 82
MluCI AATT 3 cut(s) 26, 123, 162
MnlI CCTC 1 cut(s) 34
MseI TTAA 3 cut(s) 78, 126, 161
PflMI CCANNNNNTGG 1 cut(s) 92
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
SaqAI TTAA 3 cut(s) 78, 126, 161
SetI ASST 2 cut(s) 19, 45
SfaNI GCATC 2 cut(s) 63, 140
SgeI CNNG 6 cut(s) 23, 70, 101, 113, 129, 131
Sse9I AATT 3 cut(s) 26, 123, 162
TaiI ACGT 1 cut(s) 19
TasI AATT 3 cut(s) 26, 123, 162
Tru1I TTAA 3 cut(s) 78, 126, 161
Tru9I TTAA 3 cut(s) 78, 126, 161
TscAI CASTG 1 cut(s) 105
TspDTI ATGAA 1 cut(s) 83
TspRI CASTG 1 cut(s) 105
Van91I CCANNNNNTGG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.