Rmu_sc0018381.1_g000003

cyclic nucleotide-gated ion channel

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018381.1
Physical Location & Seq
Reverse (-)
9304 .. 10155
852 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018381.1_g000003.1.cds

Sequence Viewer

Length: 609 bp
atggacgatcctatcttagatgcaatatgtgagaaactaaaacaaaaaacatacattgaaggaaatgaaattttgtatcctggaggtatggttgagaatatggtttttattgtgcgtggaaagatggagagcattggggcggatgggactgttgatgacacattaaaggaaggtgatgtttgtggtgaggaacttctcagatggtgtcttgaggcttctgtaaacactgatgggaaaaatgtcaggatcactggtcggagattgctcagcaacagattggtaaggtgcttaactaacgtggaagcatttcaactccgagctgcagacctcgaacagttcactggacgttttgcaagatacttgcggaatccacgtgtacaaggagccataaggtatgaatctccgtactggagagggcttgcagcaaagcgaattcaagtagcttggaggtacaggcaaaagcgtctaaatcgcacaagcccacagagttgcccccgaaacccttactccgatcaaagtccagcggacttcttgagatcaacttatcgcccacatagttggggacttggaaatgatgctcgggagcgggaacactggggccttttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

202

Amino Acids

23.33

Weight (kDa)

9.16

Isoelectric Point (pI)

40.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000678)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G17700 AT3G17700
fragaria_vesca FvH4_5g18080 FvH4_5g18080 FvH4_5g18080 FvH4_6g44780
malus_domestica MD06G1236300.v1.1 MD09G1093300.v1.1 MD14G1243200.v1.1
prunus_persica Prupe.1G183800_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1
pyrus_communis pycom06g21110 pycom06g21140 pycom06g21190 pycom14g20450
rosa_chinensis RchiOBHm_Chr2g0161941 RchiOBHm_Chr4g0441651 RchiOBHm_Chr5g0083381 RchiOBHm_Chr6g0281101 RchiOBHm_Chr7g0177531
rosa_laevigata RLG00000005528 RLG00000015203 RLG00000015445 RLG00000021309 RLG00000023742 RLG00000034422 RLG00000036136
rosa_multiflora Rmu_co8432259.1_g000001 Rmu_co8481019.1_g000001 Rmu_sc0003410.1_g000009 Rmu_sc0004618.1_g000030 Rmu_sc0005144.1_g000007 Rmu_sc0008565.1_g000001 Rmu_sc0018381.1_g000003 Rmu_ssc0000330.1_g000004
rosa_roxburghii Rroxscaffold_1G00051700 Rroxscaffold_2G00088450 Rroxscaffold_2G00116130 Rroxscaffold_2G00126580 Rroxscaffold_3G00275780 Rroxscaffold_5G00338690 Rroxscaffold_5G00375080
rosa_rugosa Rorug02G0493400 Rorug04G0058900 Rorug04G0059000 Rorug06G0407100
rosa_samantha Rh2AG220400 Rh2AG282700 Rh2AG329100 Rh2AG559300 Rh2BG572700 Rh2CG542900 Rh2DG582500 Rh4AG135300 Rh4BG096100 Rh4DG026800 Rh4DG329100 Rh5CG271500 Rh6DG096900 Rh7AG006400 Rh7BG006300 Rh7CG006800 Rh7DG006400 Rh7DG278200
rosa_wichuraiana Rw0G014790 Rw1G017310 Rw7G000530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 586
AciI CCGC 4 cut(s) 140, 364, 524, 586
AclWI GGATC 2 cut(s) 2, 254
AcsI RAATTY 2 cut(s) 69, 432
AcvI CACGTG 1 cut(s) 374
AfaI GTAC 3 cut(s) 378, 407, 452
AflIII ACRYGT 1 cut(s) 373
AgsI TTSAA 3 cut(s) 59, 311, 437
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 2 cut(s) 320, 443
AluI AGCT 2 cut(s) 320, 443
AlwI GGATC 2 cut(s) 2, 254
Ama87I CYCGRG 1 cut(s) 579
AoxI GGCC 1 cut(s) 598
ApeKI GCWGC 2 cut(s) 320, 422
ApoI RAATTY 2 cut(s) 69, 432
Asp700I GAANNNNTTC 1 cut(s) 306
AspS9I GGNCC 1 cut(s) 598
AsuHPI GGTGA 2 cut(s) 185, 197
AvaI CYCGRG 1 cut(s) 579
BbrPI CACGTG 1 cut(s) 374
BbvI GCAGC 2 cut(s) 307, 434
BccI CCATC 4 cut(s) 118, 137, 195, 224
BciT130I CCWGG 1 cut(s) 81
BciVI GTATCC 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 321
BfuI GTATCC 1 cut(s) 87
BisI GCNGC 2 cut(s) 321, 423
BlpI GCTNAGC 1 cut(s) 266
BlsI GCNGC 2 cut(s) 322, 424
Bme1390I CCNGG 1 cut(s) 81
BmeT110I CYCGRG 1 cut(s) 579
BmgT120I GGNCC 1 cut(s) 598
BmiI GGNNCC 2 cut(s) 385, 599
BmrFI CCNGG 1 cut(s) 81
BmrI ACTGGG 1 cut(s) 604
BmsI GCATC 2 cut(s) 10, 565
BmuI ACTGGG 1 cut(s) 604
BpmI CTGGAG 2 cut(s) 102, 430
Bpu1102I GCTNAGC 1 cut(s) 266
BpuEI CTTGAG 2 cut(s) 230, 553
BsaAI YACGTR 1 cut(s) 374
BsaXI ACNNNNNCTCC 4 cut(s) 75, 105, 491, 521
Bse1I ACTGG 4 cut(s) 256, 346, 413, 599
BseBI CCWGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 148
BseMII CTCAG 2 cut(s) 211, 280
BseNI ACTGG 4 cut(s) 256, 346, 413, 599
BseXI GCAGC 2 cut(s) 307, 434
BshFI GGCC 1 cut(s) 600
BsiHKCI CYCGRG 1 cut(s) 579
BslFI GGGAC 2 cut(s) 160, 576
BsmFI GGGAC 2 cut(s) 160, 576
BsnI GGCC 1 cut(s) 600
BsoBI CYCGRG 1 cut(s) 579
Bsp1407I TGTACA 1 cut(s) 376
Bsp143I GATC 4 cut(s) 7, 246, 511, 536
Bsp1720I GCTNAGC 1 cut(s) 266
BspACI CCGC 4 cut(s) 140, 364, 524, 586
BspANI GGCC 1 cut(s) 600
BspCNI CTCAG 2 cut(s) 210, 279
BspLI GGNNCC 2 cut(s) 385, 599
BspMAI CTGCAG 1 cut(s) 325
BspPI GGATC 2 cut(s) 2, 254
BsrBI CCGCTC 1 cut(s) 586
BsrGI TGTACA 1 cut(s) 376
BsrI ACTGG 4 cut(s) 256, 346, 413, 599
BssMI GATC 4 cut(s) 7, 246, 511, 536
Bst2UI CCWGG 1 cut(s) 81
Bst4CI ACNGT 2 cut(s) 151, 336
BstAUI TGTACA 1 cut(s) 376
BstBAI YACGTR 1 cut(s) 374
BstC8I GCNNGC 1 cut(s) 420
BstDEI CTNAG 3 cut(s) 16, 197, 266
BstF5I GGATG 1 cut(s) 148
BstKTI GATC 4 cut(s) 10, 249, 514, 539
BstMBI GATC 4 cut(s) 7, 246, 511, 536
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 321
BstV1I GCAGC 2 cut(s) 307, 434
BstXI CCANNNNNNTGG 1 cut(s) 558
BsuI GTATCC 1 cut(s) 87
BsuRI GGCC 1 cut(s) 600
BtsCI GGATG 1 cut(s) 148
BtsIMutI CAGTG 4 cut(s) 225, 249, 339, 592
Cac8I GCNNGC 1 cut(s) 420
Cfr13I GGNCC 1 cut(s) 598
CseI GACGC 1 cut(s) 452
Csp6I GTAC 3 cut(s) 377, 406, 451
CviJI RGCY 7 cut(s) 215, 320, 386, 418, 443, 480, 600
CviKI_1 RGCY 7 cut(s) 215, 320, 386, 418, 443, 480, 600
CviQI GTAC 3 cut(s) 377, 406, 451
DdeI CTNAG 3 cut(s) 16, 197, 266
DpnI GATC 4 cut(s) 9, 248, 513, 538
DpnII GATC 4 cut(s) 7, 246, 511, 536
EciI GGCGGA 1 cut(s) 155
Eco72I CACGTG 1 cut(s) 374
Eco88I CYCGRG 1 cut(s) 579
EcoO109I RGGNCCY 1 cut(s) 598
EcoRI GAATTC 1 cut(s) 432
EcoRII CCWGG 1 cut(s) 79
FaiI YATR 7 cut(s) 28, 52, 89, 101, 389, 396, 555
FaqI GGGAC 2 cut(s) 160, 576
FauI CCCGC 1 cut(s) 579
Fnu4HI GCNGC 2 cut(s) 321, 423
FokI GGATG 1 cut(s) 155
Fsp4HI GCNGC 2 cut(s) 321, 423
GluI GCNGC 2 cut(s) 321, 423
GsuI CTGGAG 2 cut(s) 102, 430
HaeIII GGCC 1 cut(s) 600
HgaI GACGC 1 cut(s) 452
HinfI GANTC 2 cut(s) 367, 398
HphI GGTGA 2 cut(s) 185, 197
Hpy166II GTNNAC 3 cut(s) 223, 339, 377
Hpy188I TCNGA 5 cut(s) 200, 258, 317, 511, 608
Hpy188III TCNNGA 4 cut(s) 209, 244, 532, 581
Hpy8I GTNNAC 3 cut(s) 223, 339, 377
HpyAV CCTTC 2 cut(s) 53, 164
HpyCH4III ACNGT 2 cut(s) 151, 336
HpyCH4IV ACGT 3 cut(s) 297, 346, 373
HpyCH4V TGCA 4 cut(s) 23, 323, 353, 422
HpyF3I CTNAG 3 cut(s) 16, 197, 266
HpySE526I ACGT 3 cut(s) 297, 346, 373
Kzo9I GATC 4 cut(s) 7, 246, 511, 536
LmnI GCTCC 2 cut(s) 383, 583
LpnPI CCDG 9 cut(s) 66, 93, 229, 237, 327, 394, 439, 534, 580
Lsp1109I GCAGC 2 cut(s) 307, 434
LweI GCATC 2 cut(s) 10, 565
MaeII ACGT 3 cut(s) 297, 346, 373
MalI GATC 4 cut(s) 9, 248, 513, 538
MbiI CCGCTC 1 cut(s) 586
MboI GATC 4 cut(s) 7, 246, 511, 536
MluCI AATT 2 cut(s) 69, 432
MmeI TCCRAC 1 cut(s) 236
MnlI CCTC 6 cut(s) 77, 181, 205, 338, 407, 441
MroXI GAANNNNTTC 1 cut(s) 306
MseI TTAA 2 cut(s) 164, 290
MspA1I CMGCKG 1 cut(s) 524
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
NdeII GATC 4 cut(s) 7, 246, 511, 536
NlaIV GGNNCC 2 cut(s) 385, 599
PdmI GAANNNNTTC 1 cut(s) 306
PfeI GAWTC 2 cut(s) 367, 398
PfoI TCCNGGA 1 cut(s) 79
PkrI GCNGC 2 cut(s) 322, 424
PmaCI CACGTG 1 cut(s) 374
PmlI CACGTG 1 cut(s) 374
Ppu21I YACGTR 1 cut(s) 374
Psp6I CCWGG 1 cut(s) 79
PspCI CACGTG 1 cut(s) 374
PspGI CCWGG 1 cut(s) 79
PspN4I GGNNCC 2 cut(s) 385, 599
PspPI GGNCC 1 cut(s) 598
PstI CTGCAG 1 cut(s) 325
RsaI GTAC 3 cut(s) 378, 407, 452
RsaNI GTAC 3 cut(s) 377, 406, 451
SaqAI TTAA 2 cut(s) 164, 290
SatI GCNGC 2 cut(s) 321, 423
Sau3AI GATC 4 cut(s) 7, 246, 511, 536
Sau96I GGNCC 1 cut(s) 598
ScrFI CCNGG 1 cut(s) 81
SfaNI GCATC 2 cut(s) 10, 565
SfcI CTRYAG 1 cut(s) 321
SmlI CTYRAG 2 cut(s) 209, 532
SmoI CTYRAG 2 cut(s) 209, 532
Sse9I AATT 2 cut(s) 69, 432
SsiI CCGC 4 cut(s) 140, 364, 524, 586
StyD4I CCNGG 1 cut(s) 79
TaaI ACNGT 2 cut(s) 151, 336
TaiI ACGT 3 cut(s) 300, 349, 376
TaqI TCGA 1 cut(s) 330
TasI AATT 2 cut(s) 69, 432
TatI WGTACW 1 cut(s) 376
TfiI GAWTC 2 cut(s) 367, 398
Tru1I TTAA 2 cut(s) 164, 290
Tru9I TTAA 2 cut(s) 164, 290
TscAI CASTG 4 cut(s) 232, 256, 346, 599
TseI GCWGC 2 cut(s) 320, 422
TspDTI ATGAA 2 cut(s) 81, 411
TspGWI ACGGA 1 cut(s) 393
TspRI CASTG 4 cut(s) 232, 256, 346, 599
XapI RAATTY 2 cut(s) 69, 432
XmnI GAANNNNTTC 1 cut(s) 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.