Rh4AG135300

PHD-finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0000678
Physical Location & Seq
Reverse (-)
29722183 .. 29723209
1027 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG135300.1

Sequence Viewer

Length: 160 bp
ATGGTGACGGCGAAGAAGAGGGTGTGGGCACTTGCACCGGATTTGTTCCCCGAGAAGCCAGTTTCGGAGCTGGATTTGAATCTTGATTCAGCTTTGAATAGCTCCATAATATTCTGTATGGTGATGCTAAAGGATGGTTTAAAAGAACCTGTTTTTTTCT
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0009966 GO:0010646 GO:0023051 GO:0030111 GO:0048583 GO:0050789 GO:0050794 GO:0060828 GO:0065007
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PHD PHD_2 zf-HC5HC2H_2

Protein Analysis

53

Amino Acids

5.97

Weight (kDa)

5.04

Isoelectric Point (pI)

43.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000678)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G17700 AT3G17700
fragaria_vesca FvH4_5g18080 FvH4_5g18080 FvH4_5g18080 FvH4_6g44780
malus_domestica MD06G1236300.v1.1 MD09G1093300.v1.1 MD14G1243200.v1.1
prunus_persica Prupe.1G183800_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.3G231900_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1 Prupe.5G240800_v2.0.a1
pyrus_communis pycom06g21110 pycom06g21140 pycom06g21190 pycom14g20450
rosa_chinensis RchiOBHm_Chr2g0161941 RchiOBHm_Chr4g0441651 RchiOBHm_Chr5g0083381 RchiOBHm_Chr6g0281101 RchiOBHm_Chr7g0177531
rosa_laevigata RLG00000005528 RLG00000015203 RLG00000015445 RLG00000021309 RLG00000023742 RLG00000034422 RLG00000036136
rosa_multiflora Rmu_co8432259.1_g000001 Rmu_co8481019.1_g000001 Rmu_sc0003410.1_g000009 Rmu_sc0004618.1_g000030 Rmu_sc0005144.1_g000007 Rmu_sc0008565.1_g000001 Rmu_sc0018381.1_g000003 Rmu_ssc0000330.1_g000004
rosa_roxburghii Rroxscaffold_1G00051700 Rroxscaffold_2G00088450 Rroxscaffold_2G00116130 Rroxscaffold_2G00126580 Rroxscaffold_3G00275780 Rroxscaffold_5G00338690 Rroxscaffold_5G00375080
rosa_rugosa Rorug02G0493400 Rorug04G0058900 Rorug04G0059000 Rorug06G0407100
rosa_samantha Rh2AG220400 Rh2AG282700 Rh2AG329100 Rh2AG559300 Rh2BG572700 Rh2CG542900 Rh2DG582500 Rh4AG135300 Rh4BG096100 Rh4DG026800 Rh4DG329100 Rh5CG271500 Rh6DG096900 Rh7AG006400 Rh7BG006300 Rh7CG006800 Rh7DG006400 Rh7DG278200
rosa_wichuraiana Rw0G014790 Rw1G017310 Rw7G000530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 79, 97
AluBI AGCT 3 cut(s) 70, 92, 102
AluI AGCT 3 cut(s) 70, 92, 102
Ama87I CYCGRG 1 cut(s) 50
AsuHPI GGTGA 2 cut(s) 16, 133
AvaI CYCGRG 1 cut(s) 50
BaeGI GKGCMC 1 cut(s) 31
BccI CCATC 1 cut(s) 128
BceAI ACGGC 1 cut(s) 24
BmeT110I CYCGRG 1 cut(s) 50
BmsI GCATC 1 cut(s) 114
BsaBI GATNNNNATC 1 cut(s) 78
BsaWI WCCGGW 1 cut(s) 37
Bse1I ACTGG 1 cut(s) 59
Bse8I GATNNNNATC 1 cut(s) 78
BseGI GGATG 1 cut(s) 139
BseJI GATNNNNATC 1 cut(s) 78
BseNI ACTGG 1 cut(s) 59
BseSI GKGCMC 1 cut(s) 31
BsiHKCI CYCGRG 1 cut(s) 50
BsiSI CCGG 1 cut(s) 38
BsoBI CYCGRG 1 cut(s) 50
Bsp1286I GDGCHC 1 cut(s) 31
BsrI ACTGG 1 cut(s) 59
Bst6I CTCTTC 1 cut(s) 11
BstF5I GGATG 1 cut(s) 139
BstSLI GKGCMC 1 cut(s) 31
BtsCI GGATG 1 cut(s) 139
CviJI RGCY 4 cut(s) 58, 70, 92, 102
CviKI_1 RGCY 4 cut(s) 58, 70, 92, 102
DraI TTTAAA 1 cut(s) 141
Eam1104I CTCTTC 1 cut(s) 11
EarI CTCTTC 1 cut(s) 11
Eco88I CYCGRG 1 cut(s) 50
FaiI YATR 2 cut(s) 107, 119
FokI GGATG 1 cut(s) 146
HapII CCGG 1 cut(s) 38
HinfI GANTC 2 cut(s) 79, 86
HpaII CCGG 1 cut(s) 38
HphI GGTGA 2 cut(s) 16, 133
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 35
LmnI GCTCC 2 cut(s) 67, 107
LpnPI CCDG 3 cut(s) 51, 56, 72
LweI GCATC 1 cut(s) 114
MaeIII GTNAC 1 cut(s) 4
MboII GAAGA 2 cut(s) 25, 28
MhlI GDGCHC 1 cut(s) 31
MnlI CCTC 1 cut(s) 12
MseI TTAA 1 cut(s) 140
MspI CCGG 1 cut(s) 38
NmuCI GTSAC 1 cut(s) 4
PfeI GAWTC 2 cut(s) 79, 86
SaqAI TTAA 1 cut(s) 140
SduI GDGCHC 1 cut(s) 31
SetI ASST 4 cut(s) 72, 94, 104, 151
SfaNI GCATC 1 cut(s) 114
SgeI CNNG 7 cut(s) 44, 50, 62, 64, 71, 83, 95
SspI AATATT 1 cut(s) 111
TfiI GAWTC 2 cut(s) 79, 86
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TseFI GTSAC 1 cut(s) 4
Tsp45I GTSAC 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.