Rh7CG077400

Wall-associated receptor kinase C-terminal

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000786
Physical Location & Seq
Forward (+)
5556449 .. 5556895
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG077400.1

Sequence Viewer

Length: 447 bp
ATGGTACCAAAAAGTCTTACGTTTTCATGGAGGGAGACAGATGGGTTTGATTGGTCTGAAAGTTGTGAGGAGAATGTGGTGGTGACTGTGAAAGAAACAGAGATTACTAGTAGTATTGATGAGTTGATTGGTTCATTTGGAGTGGCCATGAACAATGGGTTTGTGCTTAACTGGACCGTGGCTAAGGAGTGCGGTTCCTGTGAGGCTAATGGTGGCCTGTGTGGCTACAACAACCTTACTGTGCCAGAGTTTCTGTGCTTTTGCAGAGATGGTAGTATTGGTACCAGAAGCAATGGCCTCTGCAAGAAATTAGGTATGTTTGTCGATGATGCTCTCTCTTTATCTAATTATAAAGCTATGGATCTCTTTGAGCTAACAGATCAAATTGACCGATTCAGTCAAAAGATACAAATTTTCAGATGTAAGGAAAATGACCGATTCATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GUB_WAK_bind WAK_assoc

Protein Analysis

148

Amino Acids

16.59

Weight (kDa)

4.53

Isoelectric Point (pI)

26.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WAK_assoc PF14380 9 - 91 2.1e-19 Wall-associated receptor kinase C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 351
Acc65I GGTACC 2 cut(s) 4, 281
AccB1I GGYRCC 2 cut(s) 4, 281
AciI CCGC 1 cut(s) 192
AclWI GGATC 1 cut(s) 369
AcoI YGGCCR 1 cut(s) 144
AcsI RAATTY 1 cut(s) 411
AfaI GTAC 2 cut(s) 6, 283
AhlI ACTAGT 1 cut(s) 107
AluBI AGCT 2 cut(s) 356, 373
AluI AGCT 2 cut(s) 356, 373
Alw26I GTCTC 1 cut(s) 29
AlwI GGATC 1 cut(s) 369
AoxI GGCC 3 cut(s) 144, 214, 295
ApoI RAATTY 1 cut(s) 411
Asp718I GGTACC 2 cut(s) 4, 281
AspS9I GGNCC 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 94
AvaII GGWCC 1 cut(s) 174
BalI TGGCCA 1 cut(s) 146
BanI GGYRCC 2 cut(s) 4, 281
BccI CCATC 2 cut(s) 35, 263
BcoDI GTCTC 1 cut(s) 29
BcuI ACTAGT 1 cut(s) 107
BfaI CTAG 1 cut(s) 108
BglI GCCNNNNNGGC 1 cut(s) 222
Bme18I GGWCC 1 cut(s) 174
BmgT120I GGNCC 1 cut(s) 174
BmiI GGNNCC 3 cut(s) 6, 196, 283
BmsI GCATC 1 cut(s) 319
Bpu10I CCTNAGC 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 177
Bse1I ACTGG 1 cut(s) 176
Bse3DI GCAATG 1 cut(s) 298
BseDI CCNNGG 1 cut(s) 177
BseMI GCAATG 1 cut(s) 298
BseNI ACTGG 1 cut(s) 176
BseRI GAGGAG 1 cut(s) 83
BshFI GGCC 3 cut(s) 146, 216, 297
BshNI GGYRCC 2 cut(s) 4, 281
BsmAI GTCTC 1 cut(s) 29
BsnI GGCC 3 cut(s) 146, 216, 297
Bsp143I GATC 2 cut(s) 361, 379
BspACI CCGC 1 cut(s) 192
BspANI GGCC 3 cut(s) 146, 216, 297
BspLI GGNNCC 3 cut(s) 6, 196, 283
BspPI GGATC 1 cut(s) 369
BspT107I GGYRCC 2 cut(s) 4, 281
BsrDI GCAATG 1 cut(s) 298
BsrI ACTGG 1 cut(s) 176
BssECI CCNNGG 1 cut(s) 177
BssMI GATC 2 cut(s) 361, 379
Bst4CI ACNGT 3 cut(s) 88, 178, 241
BstDEI CTNAG 1 cut(s) 183
BstDSI CCRYGG 1 cut(s) 177
BstKTI GATC 2 cut(s) 364, 382
BstMAI GTCTC 1 cut(s) 29
BstMBI GATC 2 cut(s) 361, 379
BstMWI GCNNNNNNNGC 1 cut(s) 222
BstX2I RGATCY 1 cut(s) 361
BstYI RGATCY 1 cut(s) 361
BsuRI GGCC 3 cut(s) 146, 216, 297
BtgI CCRYGG 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 174
Csp6I GTAC 2 cut(s) 5, 282
CviAII CATG 2 cut(s) 27, 148
CviJI RGCY 8 cut(s) 146, 182, 206, 216, 225, 297, 356, 373
CviKI_1 RGCY 8 cut(s) 146, 182, 206, 216, 225, 297, 356, 373
CviQI GTAC 2 cut(s) 5, 282
DdeI CTNAG 1 cut(s) 183
DpnI GATC 2 cut(s) 363, 381
DpnII GATC 2 cut(s) 361, 379
EaeI YGGCCR 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 174
FaeI CATG 2 cut(s) 30, 151
FaiI YATR 5 cut(s) 28, 149, 317, 351, 359
FatI CATG 2 cut(s) 26, 147
FspBI CTAG 1 cut(s) 108
HaeIII GGCC 3 cut(s) 146, 216, 297
Hin1II CATG 2 cut(s) 30, 151
HinfI GANTC 2 cut(s) 393, 438
HphI GGTGA 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 58, 419
HpyCH4III ACNGT 3 cut(s) 88, 178, 241
HpyCH4IV ACGT 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 264, 303
HpyF10VI GCNNNNNNNGC 1 cut(s) 222
HpyF3I CTNAG 1 cut(s) 183
HpySE526I ACGT 1 cut(s) 20
Hsp92II CATG 2 cut(s) 30, 151
KpnI GGTACC 2 cut(s) 8, 285
Kzo9I GATC 2 cut(s) 361, 379
LpnPI CCDG 5 cut(s) 157, 211, 230, 258, 298
LweI GCATC 1 cut(s) 319
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 20
MaeIII GTNAC 1 cut(s) 82
MalI GATC 2 cut(s) 363, 381
MboI GATC 2 cut(s) 361, 379
MflI RGATCY 1 cut(s) 361
MlsI TGGCCA 1 cut(s) 146
MluCI AATT 4 cut(s) 308, 346, 384, 411
MluNI TGGCCA 1 cut(s) 146
MnlI CCTC 4 cut(s) 24, 61, 196, 308
Mox20I TGGCCA 1 cut(s) 146
MscI TGGCCA 1 cut(s) 146
MseI TTAA 2 cut(s) 168, 445
Msp20I TGGCCA 1 cut(s) 146
MwoI GCNNNNNNNGC 1 cut(s) 222
NdeII GATC 2 cut(s) 361, 379
NlaIII CATG 2 cut(s) 30, 151
NlaIV GGNNCC 3 cut(s) 6, 196, 283
NmuCI GTSAC 1 cut(s) 82
PfeI GAWTC 2 cut(s) 393, 438
PsiI TTATAA 1 cut(s) 351
PspN4I GGNNCC 3 cut(s) 6, 196, 283
PspPI GGNCC 1 cut(s) 174
PsuI RGATCY 1 cut(s) 361
RsaI GTAC 2 cut(s) 6, 283
RsaNI GTAC 2 cut(s) 5, 282
SaqAI TTAA 2 cut(s) 168, 445
Sau3AI GATC 2 cut(s) 361, 379
Sau96I GGNCC 1 cut(s) 174
SetI ASST 5 cut(s) 23, 237, 316, 358, 375
SfaNI GCATC 1 cut(s) 319
SinI GGWCC 1 cut(s) 174
SpeI ACTAGT 1 cut(s) 107
Sse9I AATT 4 cut(s) 308, 346, 384, 411
SsiI CCGC 1 cut(s) 192
SspMI CTAG 1 cut(s) 108
TaaI ACNGT 3 cut(s) 88, 178, 241
TaiI ACGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 324
TaqII GACCGA 1 cut(s) 405
TasI AATT 4 cut(s) 308, 346, 384, 411
TfiI GAWTC 2 cut(s) 393, 438
Tru1I TTAA 2 cut(s) 168, 445
Tru9I TTAA 2 cut(s) 168, 445
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 4 cut(s) 15, 123, 164, 430
VpaK11BI GGWCC 1 cut(s) 174
XapI RAATTY 1 cut(s) 411
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.