MD10G1108800.v1.1

meiotic spindle elongation

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Reverse (-)
17899084 .. 17902629
3546 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1108800.v1.1.491

Sequence Viewer

Length: 219 bp
ATGGTCGCGAATCAATTATACGAGTTGTGTGACATTGTTGGTCTAGAAGCTACAAGGTTGGACCTGGTGCCTTCATATGTTCGGCTTCAACGAGATAATGAGGCTGAAGTACGAATAGCTGCTGCAGGAAAGGTCATACTCTGCTTCCCACTCCTTGTACCTAGTATCGGTAAGAACCCTCTCAAAGTTTGTGAAAAATTGAACAATATTGAGATCTGA

Protein Analysis

73

Amino Acids

7.99

Weight (kDa)

5.25

Isoelectric Point (pI)

36.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPP2R1A-like_HEAT PF22646 18 - 46 2.4e-06 PPP2R1A-like HEAT repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 67
AccII CGCG 1 cut(s) 8
AcuI CTGAAG 1 cut(s) 126
AfaI GTAC 2 cut(s) 111, 159
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 2 cut(s) 89, 202
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 2 cut(s) 50, 119
AluI AGCT 2 cut(s) 50, 119
ApeKI GCWGC 2 cut(s) 119, 122
AspS9I GGNCC 1 cut(s) 61
AvaII GGWCC 1 cut(s) 61
BanI GGYRCC 1 cut(s) 67
BbvI GCAGC 2 cut(s) 106, 109
BciT130I CCWGG 1 cut(s) 65
BfaI CTAG 2 cut(s) 44, 162
BfmI CTRYAG 1 cut(s) 123
BglII AGATCT 1 cut(s) 213
BisI GCNGC 2 cut(s) 120, 123
BlsI GCNGC 2 cut(s) 121, 124
Bme1390I CCNGG 1 cut(s) 65
Bme18I GGWCC 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 69
BmrFI CCNGG 1 cut(s) 65
Bsc4I CCNNNNNNNGG 1 cut(s) 167
BseBI CCWGG 1 cut(s) 65
BseLI CCNNNNNNNGG 1 cut(s) 167
BseXI GCAGC 2 cut(s) 106, 109
Bsh1236I CGCG 1 cut(s) 8
BshNI GGYRCC 1 cut(s) 67
BslI CCNNNNNNNGG 1 cut(s) 167
Bsp143I GATC 1 cut(s) 213
Bsp68I TCGCGA 1 cut(s) 8
BspFNI CGCG 1 cut(s) 8
BspLI GGNNCC 1 cut(s) 69
BspMAI CTGCAG 1 cut(s) 127
BspT107I GGYRCC 1 cut(s) 67
BssMI GATC 1 cut(s) 213
Bst2UI CCWGG 1 cut(s) 65
BstFNI CGCG 1 cut(s) 8
BstKTI GATC 1 cut(s) 216
BstMBI GATC 1 cut(s) 213
BstNI CCWGG 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 63
BstSFI CTRYAG 1 cut(s) 123
BstUI CGCG 1 cut(s) 8
BstV1I GCAGC 2 cut(s) 106, 109
BstX2I RGATCY 1 cut(s) 213
BstYI RGATCY 1 cut(s) 213
BtuMI TCGCGA 1 cut(s) 8
Cfr13I GGNCC 1 cut(s) 61
CsiI ACCWGGT 1 cut(s) 63
Csp6I GTAC 2 cut(s) 110, 158
CviJI RGCY 4 cut(s) 50, 85, 104, 119
CviKI_1 RGCY 4 cut(s) 50, 85, 104, 119
CviQI GTAC 2 cut(s) 110, 158
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
Eco47I GGWCC 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 126
EcoRII CCWGG 1 cut(s) 63
FaiI YATR 4 cut(s) 19, 76, 78, 137
FauNDI CATATG 1 cut(s) 76
Fnu4HI GCNGC 2 cut(s) 120, 123
Fsp4HI GCNGC 2 cut(s) 120, 123
FspBI CTAG 2 cut(s) 44, 162
GluI GCNGC 2 cut(s) 120, 123
HinfI GANTC 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 218
Hpy188III TCNNGA 2 cut(s) 7, 44
HpyAV CCTTC 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 125
Kzo9I GATC 1 cut(s) 213
LpnPI CCDG 3 cut(s) 50, 77, 111
Lsp1109I GCAGC 2 cut(s) 106, 109
MabI ACCWGGT 1 cut(s) 63
MaeI CTAG 2 cut(s) 44, 162
MaeIII GTNAC 1 cut(s) 29
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MflI RGATCY 1 cut(s) 213
MluCI AATT 2 cut(s) 14, 197
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 2 cut(s) 94, 189
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
MvnI CGCG 1 cut(s) 8
NdeI CATATG 1 cut(s) 76
NdeII GATC 1 cut(s) 213
NlaIV GGNNCC 1 cut(s) 69
NmuCI GTSAC 1 cut(s) 29
NruI TCGCGA 1 cut(s) 8
PcsI WCGNNNNNNNCGW 1 cut(s) 88
PfeI GAWTC 1 cut(s) 10
PkrI GCNGC 2 cut(s) 121, 124
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 1 cut(s) 61
PstI CTGCAG 1 cut(s) 127
PsuI RGATCY 1 cut(s) 213
RruI TCGCGA 1 cut(s) 8
RsaI GTAC 2 cut(s) 111, 159
RsaNI GTAC 2 cut(s) 110, 158
SatI GCNGC 2 cut(s) 120, 123
Sau3AI GATC 1 cut(s) 213
Sau96I GGNCC 1 cut(s) 61
ScrFI CCNGG 1 cut(s) 65
SetI ASST 6 cut(s) 52, 59, 66, 121, 135, 163
SexAI ACCWGGT 1 cut(s) 63
SfcI CTRYAG 1 cut(s) 123
SinI GGWCC 1 cut(s) 61
Sse9I AATT 2 cut(s) 14, 197
SspI AATATT 1 cut(s) 208
SspMI CTAG 2 cut(s) 44, 162
StyD4I CCNGG 1 cut(s) 63
TasI AATT 2 cut(s) 14, 197
TfiI GAWTC 1 cut(s) 10
TseFI GTSAC 1 cut(s) 29
TseI GCWGC 2 cut(s) 119, 122
Tsp45I GTSAC 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 63
VpaK11BI GGWCC 1 cut(s) 61
XbaI TCTAGA 1 cut(s) 43
XspI CTAG 2 cut(s) 44, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.