Prupe.4G257700_v2.0.a1
MYB Family

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0001154
Physical Location & Seq
Forward (+)
18293859 .. 18294556
698 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G257700.1

Sequence Viewer

Length: 612 bp
ATGAACTCAACACCTACTACTGCTAGAAGGAATAGAAAGGATAAGCACATTTGGACCCCTATCGAAGATGCATTTCTAGTTGAGGCTTTAAATGAATTATGTGTTGGTGGCTGTTGGAAGGTTGACAATGGGTTTAGATCTGGATATTTGGGACAATTAGAAAAGGCTATGGAACAAAAGTTACCTGGATGTGGATTAAAAGTAGTTCCTCACATTGATTCTTGTGTGAAGACATTGAAGAAACAAACACTAGCCATCTCTGACATGCTCACCAACTCAAGTGGTTTTGCATGGAATGATGAAGAAAAAATGGTGGTATGCGAGAAACAAGTCTTTGATGATTGGGTTAAGGTCCATAATTCTGCAAAAGGATTAAGAAACAAACCATTTCCTCATCATGATACTCTAGTGGAAGCTTTTGGGAAAGATCGAGCAAATGGCAAAGGAGCTGAAGGTCCTGCTGAAGTGATTGAAGATCTTACTGATAATAATAATTTTAACTTTGAAGGAGATGGCCTAGATGACATCAATTTTTCTTCCCCTACTACCCAAACTCCTATATGCCCTCCTTCGACTCGTCCCAATAAACGGGGCACGAAAAGACAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

204

Amino Acids

22.64

Weight (kDa)

6.52

Isoelectric Point (pI)

43.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 471, 483
AfiI CCNNNNNNNGG 2 cut(s) 191, 588
AgsI TTSAA 3 cut(s) 238, 473, 506
AjnI CCWGG 1 cut(s) 184
AjuI GAANNNNNNNTTGG 2 cut(s) 87, 119
AluBI AGCT 2 cut(s) 416, 449
AluI AGCT 2 cut(s) 416, 449
AoxI GGCC 1 cut(s) 514
AspS9I GGNCC 3 cut(s) 54, 352, 455
AsuHPI GGTGA 1 cut(s) 262
AvaII GGWCC 3 cut(s) 54, 352, 455
BaeGI GKGCMC 1 cut(s) 596
BaeI ACNNNNGTAYC 2 cut(s) 393, 426
BbsI GAAGAC 1 cut(s) 236
BccI CCATC 2 cut(s) 263, 506
BciT130I CCWGG 1 cut(s) 186
BfaI CTAG 5 cut(s) 24, 77, 251, 407, 518
BglII AGATCT 2 cut(s) 137, 475
Bme1390I CCNGG 1 cut(s) 186
Bme18I GGWCC 3 cut(s) 54, 352, 455
BmgT120I GGNCC 3 cut(s) 54, 352, 455
BmiI GGNNCC 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 1 cut(s) 58
BpiI GAAGAC 1 cut(s) 236
BpuEI CTTGAG 1 cut(s) 262
BsaXI ACNNNNNCTCC 2 cut(s) 538, 568
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 588
BseBI CCWGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 194
BseLI CCNNNNNNNGG 2 cut(s) 191, 588
BseSI GKGCMC 1 cut(s) 596
BshFI GGCC 1 cut(s) 516
BslFI GGGAC 2 cut(s) 165, 564
BslI CCNNNNNNNGG 2 cut(s) 191, 588
BsmFI GGGAC 2 cut(s) 165, 564
BsnI GGCC 1 cut(s) 516
Bsp1286I GDGCHC 1 cut(s) 596
Bsp143I GATC 3 cut(s) 137, 427, 475
BspANI GGCC 1 cut(s) 516
BspHI TCATGA 1 cut(s) 397
BspLI GGNNCC 1 cut(s) 56
BssMI GATC 3 cut(s) 137, 427, 475
Bst2UI CCWGG 1 cut(s) 186
Bst4CI ACNGT 1 cut(s) 606
BstF5I GGATG 1 cut(s) 194
BstKTI GATC 3 cut(s) 140, 430, 478
BstMBI GATC 3 cut(s) 137, 427, 475
BstNI CCWGG 1 cut(s) 186
BstNSI RCATGY 1 cut(s) 268
BstSCI CCNGG 1 cut(s) 184
BstSLI GKGCMC 1 cut(s) 596
BstV2I GAAGAC 1 cut(s) 236
BstX2I RGATCY 2 cut(s) 137, 475
BstYI RGATCY 2 cut(s) 137, 475
BsuRI GGCC 1 cut(s) 516
BtsCI GGATG 1 cut(s) 194
CciI TCATGA 1 cut(s) 397
Cfr13I GGNCC 3 cut(s) 54, 352, 455
CspCI CAANNNNNGTGG 2 cut(s) 262, 297
CviAII CATG 3 cut(s) 265, 291, 398
CviJI RGCY 7 cut(s) 86, 111, 167, 254, 416, 449, 516
CviKI_1 RGCY 7 cut(s) 86, 111, 167, 254, 416, 449, 516
DpnI GATC 3 cut(s) 139, 429, 477
DpnII GATC 3 cut(s) 137, 427, 475
DraI TTTAAA 1 cut(s) 90
Eco47I GGWCC 3 cut(s) 54, 352, 455
Eco57I CTGAAG 2 cut(s) 471, 483
EcoO109I RGGNCCY 1 cut(s) 455
EcoRII CCWGG 1 cut(s) 184
EcoT22I ATGCAT 1 cut(s) 73
FaeI CATG 3 cut(s) 268, 294, 401
FaiI YATR 9 cut(s) 100, 170, 266, 292, 319, 357, 399, 560, 562
FaqI GGGAC 2 cut(s) 165, 564
FatI CATG 3 cut(s) 264, 290, 397
FokI GGATG 1 cut(s) 201
FspBI CTAG 5 cut(s) 24, 77, 251, 407, 518
HaeIII GGCC 1 cut(s) 516
Hin1II CATG 3 cut(s) 268, 294, 401
HincII GTYRAC 1 cut(s) 124
HindII GTYRAC 1 cut(s) 124
HindIII AAGCTT 1 cut(s) 414
HinfI GANTC 2 cut(s) 218, 574
HphI GGTGA 1 cut(s) 262
Hpy166II GTNNAC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 262
Hpy188III TCNNGA 2 cut(s) 141, 398
Hpy8I GTNNAC 1 cut(s) 124
HpyAV CCTTC 5 cut(s) 21, 112, 446, 500, 579
HpyCH4III ACNGT 1 cut(s) 606
HpyCH4V TGCA 3 cut(s) 71, 290, 365
Hsp92II CATG 3 cut(s) 268, 294, 401
Kzo9I GATC 3 cut(s) 137, 427, 475
LmnI GCTCC 1 cut(s) 446
LpnPI CCDG 4 cut(s) 126, 171, 198, 471
LweI GCATC 1 cut(s) 58
MaeI CTAG 5 cut(s) 24, 77, 251, 407, 518
MaeIII GTNAC 1 cut(s) 180
MalI GATC 3 cut(s) 139, 429, 477
MboI GATC 3 cut(s) 137, 427, 475
MboII GAAGA 6 cut(s) 77, 241, 250, 314, 485, 528
MflI RGATCY 2 cut(s) 137, 475
MhlI GDGCHC 1 cut(s) 596
MluCI AATT 5 cut(s) 95, 155, 358, 493, 529
MlyI GAGTC 1 cut(s) 568
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 4 cut(s) 76, 219, 402, 576
Mph1103I ATGCAT 1 cut(s) 73
MseI TTAA 5 cut(s) 89, 197, 348, 374, 498
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeII GATC 3 cut(s) 137, 427, 475
NlaIII CATG 3 cut(s) 268, 294, 401
NlaIV GGNNCC 1 cut(s) 56
NsiI ATGCAT 1 cut(s) 73
NspI RCATGY 1 cut(s) 268
PagI TCATGA 1 cut(s) 397
PfeI GAWTC 1 cut(s) 218
PleI GAGTC 1 cut(s) 568
PpsI GAGTC 1 cut(s) 568
PpuMI RGGWCCY 1 cut(s) 455
Psp5II RGGWCCY 1 cut(s) 455
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 56
PspPI GGNCC 3 cut(s) 54, 352, 455
PspPPI RGGWCCY 1 cut(s) 455
PsrI GAACNNNNNNTAC 2 cut(s) 165, 197
PsuI RGATCY 2 cut(s) 137, 475
SaqAI TTAA 5 cut(s) 89, 197, 348, 374, 498
Sau3AI GATC 3 cut(s) 137, 427, 475
Sau96I GGNCC 3 cut(s) 54, 352, 455
SchI GAGTC 1 cut(s) 568
ScrFI CCNGG 1 cut(s) 186
SduI GDGCHC 1 cut(s) 596
SetI ASST 7 cut(s) 16, 123, 187, 354, 418, 451, 457
SfaNI GCATC 1 cut(s) 58
SinI GGWCC 3 cut(s) 54, 352, 455
SmlI CTYRAG 1 cut(s) 277
SmoI CTYRAG 1 cut(s) 277
Sse9I AATT 5 cut(s) 95, 155, 358, 493, 529
SspMI CTAG 5 cut(s) 24, 77, 251, 407, 518
StyD4I CCNGG 1 cut(s) 184
TaaI ACNGT 1 cut(s) 606
TaqI TCGA 3 cut(s) 63, 430, 572
TasI AATT 5 cut(s) 95, 155, 358, 493, 529
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 5 cut(s) 89, 197, 348, 374, 498
Tru9I TTAA 5 cut(s) 89, 197, 348, 374, 498
TspDTI ATGAA 3 cut(s) 17, 108, 315
VpaK11BI GGWCC 3 cut(s) 54, 352, 455
XceI RCATGY 1 cut(s) 268
XspI CTAG 5 cut(s) 24, 77, 251, 407, 518
Zsp2I ATGCAT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.