Rmu_sc0000233.1_g000006
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000233.1
OG0001154
Physical Location & Seq
Forward (+)
21231 .. 21572
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000233.1_g000006.1.cds

Sequence Viewer

Length: 342 bp
atgttcatgacgttttcttcttttagtatggattctcaatcaatcgatcagcagaaaggaagaggaagaaataaacataagtggacctcgattgaggatgaaaaattagttgaagctatggtggaggtatgtgtttcaggaacaatgaagagtgacaatggtttcaaaccaggaacatttattcaaattgaaaagttactagagcagaagttgctgggtaatgggatcaaagctagtccacatattgagtctcgggtaaagacactaaagaaacaatataatgctatatcagatatgattgcaccagcagtggtttttcatgggatgatgagaagaaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

113

Amino Acids

12.81

Weight (kDa)

9.63

Isoelectric Point (pI)

46.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 233
AgsI TTSAA 4 cut(s) 113, 166, 185, 191
AjnI CCWGG 1 cut(s) 169
AluBI AGCT 2 cut(s) 116, 233
AluI AGCT 2 cut(s) 116, 233
Alw26I GTCTC 1 cut(s) 255
AlwI GGATC 1 cut(s) 233
Ama87I CYCGRG 1 cut(s) 252
AspS9I GGNCC 1 cut(s) 84
AvaI CYCGRG 1 cut(s) 252
AvaII GGWCC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 171
BcoDI GTCTC 1 cut(s) 255
BfaI CTAG 2 cut(s) 200, 234
Bme1390I CCNGG 1 cut(s) 171
Bme18I GGWCC 1 cut(s) 84
BmeT110I CYCGRG 1 cut(s) 252
BmgT120I GGNCC 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 171
Bsa29I ATCGAT 1 cut(s) 45
BseBI CCWGG 1 cut(s) 171
BseCI ATCGAT 1 cut(s) 45
BseGI GGATG 2 cut(s) 103, 330
BseYI CCCAGC 1 cut(s) 214
BshVI ATCGAT 1 cut(s) 45
BsiHKCI CYCGRG 1 cut(s) 252
BsmAI GTCTC 1 cut(s) 255
BsoBI CYCGRG 1 cut(s) 252
Bsp143I GATC 2 cut(s) 46, 225
BspDI ATCGAT 1 cut(s) 45
BspHI TCATGA 1 cut(s) 6
BspPI GGATC 1 cut(s) 233
BssMI GATC 2 cut(s) 46, 225
Bst2UI CCWGG 1 cut(s) 171
Bst6I CTCTTC 2 cut(s) 55, 143
BstAPI GCANNNNNTGC 1 cut(s) 211
BstF5I GGATG 2 cut(s) 103, 330
BstKTI GATC 2 cut(s) 49, 228
BstMAI GTCTC 1 cut(s) 255
BstMBI GATC 2 cut(s) 46, 225
BstMWI GCNNNNNNNGC 1 cut(s) 211
BstNI CCWGG 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 169
Bsu15I ATCGAT 1 cut(s) 45
BsuTUI ATCGAT 1 cut(s) 45
BtsCI GGATG 2 cut(s) 103, 330
BtsI GCAGTG 1 cut(s) 315
BtsIMutI CAGTG 1 cut(s) 315
CciI TCATGA 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 84
ClaI ATCGAT 1 cut(s) 45
CviAII CATG 2 cut(s) 7, 320
CviJI RGCY 2 cut(s) 116, 233
CviKI_1 RGCY 2 cut(s) 116, 233
DpnI GATC 2 cut(s) 48, 227
DpnII GATC 2 cut(s) 46, 225
Eam1104I CTCTTC 2 cut(s) 55, 143
EarI CTCTTC 2 cut(s) 55, 143
Eco47I GGWCC 1 cut(s) 84
Eco88I CYCGRG 1 cut(s) 252
EcoRII CCWGG 1 cut(s) 169
FaeI CATG 2 cut(s) 10, 323
FatI CATG 2 cut(s) 6, 319
FokI GGATG 2 cut(s) 110, 337
FspBI CTAG 2 cut(s) 200, 234
GsaI CCCAGC 1 cut(s) 218
Hin1II CATG 2 cut(s) 10, 323
HinfI GANTC 2 cut(s) 32, 248
Hpy166II GTNNAC 2 cut(s) 84, 239
Hpy188I TCNGA 1 cut(s) 292
Hpy188III TCNNGA 2 cut(s) 7, 138
Hpy8I GTNNAC 2 cut(s) 84, 239
HpyCH4IV ACGT 1 cut(s) 11
HpyCH4V TGCA 1 cut(s) 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 211
HpySE526I ACGT 1 cut(s) 11
Hsp92II CATG 2 cut(s) 10, 323
Kzo9I GATC 2 cut(s) 46, 225
LpnPI CCDG 5 cut(s) 123, 156, 183, 200, 318
MaeI CTAG 2 cut(s) 200, 234
MaeII ACGT 1 cut(s) 11
MaeIII GTNAC 2 cut(s) 152, 195
MalI GATC 2 cut(s) 48, 227
MboI GATC 2 cut(s) 46, 225
MboII GAAGA 4 cut(s) 9, 72, 78, 160
MluCI AATT 2 cut(s) 104, 186
MlyI GAGTC 1 cut(s) 257
MnlI CCTC 4 cut(s) 56, 88, 97, 118
MspR9I CCNGG 1 cut(s) 171
MvaI CCWGG 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 211
NdeII GATC 2 cut(s) 46, 225
NlaIII CATG 2 cut(s) 10, 323
NmuCI GTSAC 1 cut(s) 152
PagI TCATGA 1 cut(s) 6
PfeI GAWTC 1 cut(s) 32
PleI GAGTC 1 cut(s) 256
PpsI GAGTC 1 cut(s) 256
Psp6I CCWGG 1 cut(s) 169
PspFI CCCAGC 1 cut(s) 214
PspGI CCWGG 1 cut(s) 169
PspPI GGNCC 1 cut(s) 84
Sau3AI GATC 2 cut(s) 46, 225
Sau96I GGNCC 1 cut(s) 84
SchI GAGTC 1 cut(s) 257
ScrFI CCNGG 1 cut(s) 171
SetI ASST 5 cut(s) 14, 89, 118, 129, 235
SinI GGWCC 1 cut(s) 84
Sse9I AATT 2 cut(s) 104, 186
SspMI CTAG 2 cut(s) 200, 234
StyD4I CCNGG 1 cut(s) 169
TaiI ACGT 1 cut(s) 14
TaqI TCGA 2 cut(s) 45, 89
TasI AATT 2 cut(s) 104, 186
TfiI GAWTC 1 cut(s) 32
TscAI CASTG 1 cut(s) 315
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
TspDTI ATGAA 3 cut(s) 114, 161, 308
TspRI CASTG 1 cut(s) 315
VpaK11BI GGWCC 1 cut(s) 84
XspI CTAG 2 cut(s) 200, 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.