Rh7CG042500
MYB Family

nuclease HARBI1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
2788549 .. 2788899
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG042500.1

Sequence Viewer

Length: 351 bp
ATGAGTCTGTTTTCAGCTTATCAATTCTCTATGAATACCATTCTTTTATGTAGGATGGATTTGCAAGCAAACTCAAGATCGTCAACTAGTAGAAGTGGAAGAAATAAAGAGAAGCAACCATCACACACTTGGATCCCTATTGAAGATGTGGCTCTGGTTGAGGCTTTAACTGAATTTTGTGTTTCTGGGACTTGGAAGGTTGACAATGGATTCAAGGCAGGATATTTGGGACAACTGGAAAAAATTATAGAGCAAAAGCTACCAAATTGTGTTTTAAAGGTGAACCCCCACATTGAGTCTAGTGTTAAGACACTAAAGAAACAAACACTTGCCATCTCTGACATGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.03

Weight (kDa)

8.84

Isoelectric Point (pI)

49.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 127, 140
AcsI RAATTY 1 cut(s) 173
AgsI TTSAA 2 cut(s) 143, 214
AhlI ACTAGT 1 cut(s) 86
AluBI AGCT 2 cut(s) 17, 259
AluI AGCT 2 cut(s) 17, 259
AlwI GGATC 2 cut(s) 127, 140
ApoI RAATTY 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 292
BamHI GGATCC 1 cut(s) 132
BccI CCATC 3 cut(s) 49, 127, 341
BcuI ACTAGT 1 cut(s) 86
BfaI CTAG 2 cut(s) 87, 300
BmiI GGNNCC 1 cut(s) 134
BpuEI CTTGAG 1 cut(s) 58
Bse1I ACTGG 1 cut(s) 240
BseGI GGATG 1 cut(s) 60
BseNI ACTGG 1 cut(s) 240
BslFI GGGAC 2 cut(s) 202, 243
BsmFI GGGAC 2 cut(s) 202, 243
Bsp143I GATC 2 cut(s) 77, 132
BspLI GGNNCC 1 cut(s) 134
BspPI GGATC 2 cut(s) 127, 140
BsrI ACTGG 1 cut(s) 240
BssMI GATC 2 cut(s) 77, 132
BstC8I GCNNGC 1 cut(s) 66
BstF5I GGATG 1 cut(s) 60
BstKTI GATC 2 cut(s) 80, 135
BstMBI GATC 2 cut(s) 77, 132
BstX2I RGATCY 1 cut(s) 132
BstYI RGATCY 1 cut(s) 132
BtsCI GGATG 1 cut(s) 60
Cac8I GCNNGC 1 cut(s) 66
CviAII CATG 1 cut(s) 343
CviJI RGCY 4 cut(s) 17, 152, 164, 259
CviKI_1 RGCY 4 cut(s) 17, 152, 164, 259
DpnI GATC 2 cut(s) 79, 134
DpnII GATC 2 cut(s) 77, 132
DraI TTTAAA 1 cut(s) 276
FaeI CATG 1 cut(s) 346
FaiI YATR 5 cut(s) 32, 49, 248, 344, 349
FaqI GGGAC 2 cut(s) 202, 243
FatI CATG 1 cut(s) 342
FokI GGATG 1 cut(s) 67
FspBI CTAG 2 cut(s) 87, 300
Hin1II CATG 1 cut(s) 346
HincII GTYRAC 2 cut(s) 84, 202
HindII GTYRAC 2 cut(s) 84, 202
HinfI GANTC 3 cut(s) 4, 210, 296
HphI GGTGA 1 cut(s) 292
Hpy166II GTNNAC 3 cut(s) 84, 202, 283
Hpy188I TCNGA 1 cut(s) 340
Hpy188III TCNNGA 1 cut(s) 75
Hpy8I GTNNAC 3 cut(s) 84, 202, 283
HpyAV CCTTC 1 cut(s) 190
HpyCH4V TGCA 1 cut(s) 64
Hsp92II CATG 1 cut(s) 346
Kzo9I GATC 2 cut(s) 77, 132
LpnPI CCDG 4 cut(s) 140, 171, 204, 221
MaeI CTAG 2 cut(s) 87, 300
MalI GATC 2 cut(s) 79, 134
MboI GATC 2 cut(s) 77, 132
MboII GAAGA 2 cut(s) 111, 155
MflI RGATCY 1 cut(s) 132
MluCI AATT 4 cut(s) 23, 173, 243, 265
MlyI GAGTC 2 cut(s) 13, 305
MnlI CCTC 1 cut(s) 154
MseI TTAA 3 cut(s) 167, 275, 306
NdeII GATC 2 cut(s) 77, 132
NlaIII CATG 1 cut(s) 346
NlaIV GGNNCC 1 cut(s) 134
PfeI GAWTC 1 cut(s) 210
PleI GAGTC 2 cut(s) 12, 304
PpsI GAGTC 2 cut(s) 12, 304
PspN4I GGNNCC 1 cut(s) 134
PsuI RGATCY 1 cut(s) 132
SaqAI TTAA 3 cut(s) 167, 275, 306
Sau3AI GATC 2 cut(s) 77, 132
SchI GAGTC 2 cut(s) 13, 305
SetI ASST 4 cut(s) 19, 201, 261, 282
SmlI CTYRAG 1 cut(s) 73
SmoI CTYRAG 1 cut(s) 73
SpeI ACTAGT 1 cut(s) 86
Sse9I AATT 4 cut(s) 23, 173, 243, 265
SspMI CTAG 2 cut(s) 87, 300
TasI AATT 4 cut(s) 23, 173, 243, 265
TfiI GAWTC 1 cut(s) 210
Tru1I TTAA 3 cut(s) 167, 275, 306
Tru9I TTAA 3 cut(s) 167, 275, 306
TspDTI ATGAA 1 cut(s) 47
XapI RAATTY 1 cut(s) 173
XcmI CCANNNNNNNNNTGG 1 cut(s) 126
XspI CTAG 2 cut(s) 87, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.