Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4A

Orthogroup ID

OG0001154

Physical Location & Seq

Genomic Coordinates Reverse (-)

64910960 .. 64912170

Gene Structure 1211 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4AG339700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 726 bp

ATGGATTTGCAAGCAAACTCAAGATCCTCAACTGCTAGAAGTGGAAGAAATAAAGAGAAGCAACCATCACACACCTGGACCCCTATTGAAGATGTAGCTCTAGTTGAGGCTTTGACTGAACTTTGTGTTTATGGGGTATGGAAGGTTGACAATGGATTCAAGGCAGGATATTTGGGACAACTAGAAAAAATTATAGAGCAAAAGCTACCAAATTGTGGATTAAAGGCGAATCCCCACATTGAGTCTCGTGTTAAGACACTAAAGAAACAAACACTTACAATCTCTGACATGATTGTTAACTCCAGTGGCTTCTCATGGGACCATGAAAATAAAATGGTTGTTTGTGAAAAACAAGTTTATGACGATTGGGTTAAGGTTCACAAGGAAGCCAAAGGACTAAGACTTAAACCATTCATTCATTATGATAGTTTGGTGGAAGCTTTTGGGAGAGATAGAGCCAATGGGTTAGGAGCTGAAGGACATGCAGAAGCTGATGAAGATGTGAATAATGATAATGAATTTGTTGATCTTGAAGGACCTGCAGAAGCTGAAAATATTGTTCCTACACCTGCTACTCGTACAACTTCCTCTGCTTCTAATTCAACTCGGACTAGAAAGCTAGCAAGGGACGCTTATGCTCAATGCTTGGGAGACATGGCTAGCACACTTCGCTCCTTTGTGGATGTGACCAAGACACACTTGAAGACTATGAAAGAAGTACTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

241

Amino Acids

26.85

Weight (kDa)

6.19

Isoelectric Point (pI)

41.92

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Myb_DNA-bind_3	PF12776	25 - 121	1.8e-07	Myb/SANT-like DNA-binding domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001154)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g08194
prunus_persica	Prupe.4G257700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0343671 RchiOBHm_Chr5g0072391 RchiOBHm_Chr6g0274461 RchiOBHm_Chr6g0284621
rosa_laevigata	RLG00000001201 RLG00000008793 RLG00000013285 RLG00000013580 RLG00000015412 RLG00000020159 RLG00000022735 RLG00000029912 RLG00000030782 RLG00000032954
rosa_multiflora	Rmu_sc0000233.1_g000006 Rmu_sc0001240.1_g000006 Rmu_sc0002352.1_g000014 Rmu_sc0003882.1_g000036 Rmu_sc0004016.1_g000017 Rmu_sc0004698.1_g000002 Rmu_sc0006651.1_g000003 Rmu_sc0009984.1_g000002 Rmu_sc0010945.1_g000001
rosa_roxburghii	Rroxscaffold_2G00083960 Rroxscaffold_2G00137540 Rroxscaffold_2G00137550 Rroxscaffold_3G00226540 Rroxscaffold_3G00276350 Rroxscaffold_7G00175350
rosa_rugosa	Rorug02G0052000 Rorug04G0314300 Rorug05G0057300 Rorug06G0033500
rosa_samantha	Rh1CG381500 Rh2DG003400 Rh3BG333400 Rh4AG123000 Rh4AG311600 Rh4AG339700 Rh4CG303900 Rh4CG334100 Rh5AG318400 Rh5BG324000 Rh6AG407700 Rh6BG340400 Rh7AG126300 Rh7CG042400 Rh7CG042500 Rh7CG154400 Rh7CG166300 Rh7CG315500
rosa_wichuraiana	Rw5G010820 Rw5G026590 Rw6G003280 Rw6G021230 Rw7G013220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	577
Acc36I	ACCTGC	2 cut(s)	547, 577
AccB7I	CCANNNNNTGG	1 cut(s)	215
AclWI	GGATC	1 cut(s)	18
AcsI	RAATTY	1 cut(s)	518
AcuI	CTGAAG	1 cut(s)	495
AfaI	GTAC	2 cut(s)	580, 720
AfiI	CCNNNNNNNGG	1 cut(s)	215
AgsI	TTSAA	5 cut(s)	89, 160, 533, 603, 703
AjnI	CCWGG	1 cut(s)	74
AluBI	AGCT	7 cut(s)	98, 205, 440, 473, 491, 548, 619
AluI	AGCT	7 cut(s)	98, 205, 440, 473, 491, 548, 619
Alw26I	GTCTC	2 cut(s)	249, 645
AlwI	GGATC	1 cut(s)	18
AlwNI	CAGNNNCTG	2 cut(s)	491, 548
ApoI	RAATTY	1 cut(s)	518
AspS9I	GGNCC	3 cut(s)	78, 319, 536
AsuNHI	GCTAGC	2 cut(s)	619, 659
AvaII	GGWCC	3 cut(s)	78, 319, 536
BauI	CACGAG	1 cut(s)	246
BbsI	GAAGAC	1 cut(s)	710
BccI	CCATC	1 cut(s)	73
BciT130I	CCWGG	1 cut(s)	76
BcoDI	GTCTC	2 cut(s)	249, 645
BfaI	CTAG	6 cut(s)	36, 101, 182, 612, 620, 660
BfmI	CTRYAG	1 cut(s)	540
BfuAI	ACCTGC	2 cut(s)	547, 577
BmcAI	AGTACT	1 cut(s)	720
Bme1390I	CCNGG	1 cut(s)	76
Bme18I	GGWCC	3 cut(s)	78, 319, 536
BmgT120I	GGNCC	3 cut(s)	78, 319, 536
BmiI	GGNNCC	2 cut(s)	80, 320
BmrFI	CCNGG	1 cut(s)	76
BmtI	GCTAGC	2 cut(s)	623, 663
BpiI	GAAGAC	1 cut(s)	710
BpmI	CTGGAG	1 cut(s)	286
BpuEI	CTTGAG	1 cut(s)	4
Bsc4I	CCNNNNNNNGG	1 cut(s)	215
Bse1I	ACTGG	1 cut(s)	303
BseBI	CCWGG	1 cut(s)	76
BseGI	GGATG	1 cut(s)	688
BseLI	CCNNNNNNNGG	1 cut(s)	215
BseNI	ACTGG	1 cut(s)	303
BslFI	GGGAC	3 cut(s)	189, 332, 641
BslI	CCNNNNNNNGG	1 cut(s)	215
BsmAI	GTCTC	2 cut(s)	249, 645
BsmFI	GGGAC	3 cut(s)	189, 332, 641
Bsp143I	GATC	2 cut(s)	23, 526
BspLI	GGNNCC	2 cut(s)	80, 320
BspMAI	CTGCAG	1 cut(s)	544
BspMI	ACCTGC	2 cut(s)	547, 577
BspOI	GCTAGC	2 cut(s)	623, 663
BspPI	GGATC	1 cut(s)	18
BsrI	ACTGG	1 cut(s)	303
BssMI	GATC	2 cut(s)	23, 526
BssSI	CACGAG	1 cut(s)	246
Bst2BI	CACGAG	1 cut(s)	246
Bst2UI	CCWGG	1 cut(s)	76
BstC8I	GCNNGC	3 cut(s)	12, 621, 661
BstDEI	CTNAG	1 cut(s)	398
BstF5I	GGATG	1 cut(s)	688
BstKTI	GATC	2 cut(s)	26, 529
BstMAI	GTCTC	2 cut(s)	249, 645
BstMBI	GATC	2 cut(s)	23, 526
BstMWI	GCNNNNNNNGC	2 cut(s)	629, 669
BstNI	CCWGG	1 cut(s)	76
BstNSI	RCATGY	1 cut(s)	485
BstSCI	CCNGG	1 cut(s)	74
BstSFI	CTRYAG	1 cut(s)	540
BstV2I	GAAGAC	1 cut(s)	710
BstX2I	RGATCY	1 cut(s)	23
BstYI	RGATCY	1 cut(s)	23
BtsCI	GGATG	1 cut(s)	688
BtsIMutI	CAGTG	1 cut(s)	310
BveI	ACCTGC	2 cut(s)	547, 577
Cac8I	GCNNGC	3 cut(s)	12, 621, 661
CaiI	CAGNNNCTG	2 cut(s)	491, 548
Cfr13I	GGNCC	3 cut(s)	78, 319, 536
CseI	GACGC	1 cut(s)	638
Csp6I	GTAC	2 cut(s)	579, 719
CviAII	CATG	5 cut(s)	289, 315, 323, 482, 655
CviQI	GTAC	2 cut(s)	579, 719
DdeI	CTNAG	1 cut(s)	398
DpnI	GATC	2 cut(s)	25, 528
DpnII	GATC	2 cut(s)	23, 526
Eco47I	GGWCC	3 cut(s)	78, 319, 536
Eco57I	CTGAAG	1 cut(s)	495
EcoO109I	RGGNCCY	1 cut(s)	536
EcoRII	CCWGG	1 cut(s)	74
FaeI	CATG	5 cut(s)	292, 318, 326, 485, 658
FalI	AAGNNNNNCTT	5 cut(s)	616, 648, 683, 715, 705
FaqI	GGGAC	3 cut(s)	189, 332, 641
FatI	CATG	5 cut(s)	288, 314, 322, 481, 654
FokI	GGATG	1 cut(s)	695
FspBI	CTAG	6 cut(s)	36, 101, 182, 612, 620, 660
GsuI	CTGGAG	1 cut(s)	286
HgaI	GACGC	1 cut(s)	638
Hin1II	CATG	5 cut(s)	292, 318, 326, 485, 658
HincII	GTYRAC	2 cut(s)	148, 298
HindII	GTYRAC	2 cut(s)	148, 298
HindIII	AAGCTT	1 cut(s)	438
HinfI	GANTC	3 cut(s)	156, 229, 242
HpaI	GTTAAC	1 cut(s)	298
Hpy166II	GTNNAC	3 cut(s)	148, 298, 379
Hpy188I	TCNGA	2 cut(s)	286, 609
Hpy188III	TCNNGA	2 cut(s)	21, 530
Hpy8I	GTNNAC	3 cut(s)	148, 298, 379
HpyAV	CCTTC	3 cut(s)	136, 470, 527
HpyCH4V	TGCA	3 cut(s)	10, 485, 542
HpyF10VI	GCNNNNNNNGC	2 cut(s)	629, 669
HpyF3I	CTNAG	1 cut(s)	398
Hsp92II	CATG	5 cut(s)	292, 318, 326, 485, 658
KspAI	GTTAAC	1 cut(s)	298
Kzo9I	GATC	2 cut(s)	23, 526
LmnI	GCTCC	2 cut(s)	470, 677
LpnPI	CCDG	6 cut(s)	61, 88, 150, 316, 552, 582
MaeI	CTAG	6 cut(s)	36, 101, 182, 612, 620, 660
MaeIII	GTNAC	1 cut(s)	685
MalI	GATC	2 cut(s)	25, 528
MboI	GATC	2 cut(s)	23, 526
MboII	GAAGA	4 cut(s)	57, 101, 509, 715
MflI	RGATCY	1 cut(s)	23
MluCI	AATT	4 cut(s)	189, 211, 518, 598
MlyI	GAGTC	1 cut(s)	251
MnlI	CCTC	3 cut(s)	37, 100, 598
MseI	TTAA	6 cut(s)	221, 252, 297, 372, 405, 724
MspR9I	CCNGG	1 cut(s)	76
MvaI	CCWGG	1 cut(s)	76
MwoI	GCNNNNNNNGC	2 cut(s)	629, 669
NdeII	GATC	2 cut(s)	23, 526
NheI	GCTAGC	2 cut(s)	619, 659
NlaIII	CATG	5 cut(s)	292, 318, 326, 485, 658
NlaIV	GGNNCC	2 cut(s)	80, 320
NmuCI	GTSAC	1 cut(s)	685
NspI	RCATGY	1 cut(s)	485
PaqCI	CACCTGC	1 cut(s)	577
PfeI	GAWTC	2 cut(s)	156, 229
PflMI	CCANNNNNTGG	1 cut(s)	215
PleI	GAGTC	1 cut(s)	250
PpsI	GAGTC	1 cut(s)	250
PpuMI	RGGWCCY	1 cut(s)	536
Psp5II	RGGWCCY	1 cut(s)	536
Psp6I	CCWGG	1 cut(s)	74
PspGI	CCWGG	1 cut(s)	74
PspN4I	GGNNCC	2 cut(s)	80, 320
PspPI	GGNCC	3 cut(s)	78, 319, 536
PspPPI	RGGWCCY	1 cut(s)	536
PstI	CTGCAG	1 cut(s)	544
PstNI	CAGNNNCTG	2 cut(s)	491, 548
PsuI	RGATCY	1 cut(s)	23
RsaI	GTAC	2 cut(s)	580, 720
RsaNI	GTAC	2 cut(s)	579, 719
SaqAI	TTAA	6 cut(s)	221, 252, 297, 372, 405, 724
Sau3AI	GATC	2 cut(s)	23, 526
Sau96I	GGNCC	3 cut(s)	78, 319, 536
ScaI	AGTACT	1 cut(s)	720
SchI	GAGTC	1 cut(s)	251
ScrFI	CCNGG	1 cut(s)	76
SfcI	CTRYAG	1 cut(s)	540
SinI	GGWCC	3 cut(s)	78, 319, 536
SmlI	CTYRAG	1 cut(s)	19
SmoI	CTYRAG	1 cut(s)	19
Sse9I	AATT	4 cut(s)	189, 211, 518, 598
SspI	AATATT	1 cut(s)	556
SspMI	CTAG	6 cut(s)	36, 101, 182, 612, 620, 660
StyD4I	CCNGG	1 cut(s)	74
TasI	AATT	4 cut(s)	189, 211, 518, 598
TatI	WGTACW	1 cut(s)	718
TfiI	GAWTC	2 cut(s)	156, 229
Tru1I	TTAA	6 cut(s)	221, 252, 297, 372, 405, 724
Tru9I	TTAA	6 cut(s)	221, 252, 297, 372, 405, 724
TscAI	CASTG	1 cut(s)	310
TseFI	GTSAC	1 cut(s)	685
Tsp45I	GTSAC	1 cut(s)	685
TspDTI	ATGAA	6 cut(s)	339, 403, 407, 510, 531, 725
TspRI	CASTG	1 cut(s)	310
Van91I	CCANNNNNTGG	1 cut(s)	215
VpaK11BI	GGWCC	3 cut(s)	78, 319, 536
XapI	RAATTY	1 cut(s)	518
XceI	RCATGY	1 cut(s)	485
XcmI	CCANNNNNNNNNTGG	1 cut(s)	72
XspI	CTAG	6 cut(s)	36, 101, 182, 612, 620, 660
ZrmI	AGTACT	1 cut(s)	720

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.