Rmu_sc0010945.1_g000001
MYB Family

nuclease HARBI1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010945.1
Physical Location & Seq
Reverse (-)
1 .. 652
652 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010945.1_g000001.1.cds

Sequence Viewer

Length: 375 bp
atggatttgcaagcaaactcaagatcctcaactgctagaagtggaagaaataaggagaagcaaccatcacacacctggacccctattgaagatgtagctctagttgaggctttgactgaactttgtgtttctggggtatggaaggttgacaatggattcaaggcaggatatttaggacaaatagaaaaaattatagagcaaaagctaccaaattgtggattaaaggcgaatccccacattgagtctcgtgttaagacactaaagaaacaaacacttgcaatctctgacatgattgctaactccagtggcttctcatgggaccatgaaaataaaatggttgtttgtgaaaaacaagtttatgacgattgggttaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

14.05

Weight (kDa)

7.71

Isoelectric Point (pI)

54.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 215
AclWI GGATC 1 cut(s) 18
AfiI CCNNNNNNNGG 1 cut(s) 215
AgsI TTSAA 2 cut(s) 89, 160
AjnI CCWGG 1 cut(s) 74
AluBI AGCT 2 cut(s) 98, 205
AluI AGCT 2 cut(s) 98, 205
Alw26I GTCTC 1 cut(s) 249
AlwI GGATC 1 cut(s) 18
AspS9I GGNCC 2 cut(s) 78, 319
AvaII GGWCC 2 cut(s) 78, 319
BauI CACGAG 1 cut(s) 246
BccI CCATC 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 76
BcoDI GTCTC 1 cut(s) 249
BfaI CTAG 2 cut(s) 36, 101
Bme1390I CCNGG 1 cut(s) 76
Bme18I GGWCC 2 cut(s) 78, 319
BmgT120I GGNCC 2 cut(s) 78, 319
BmiI GGNNCC 2 cut(s) 80, 320
BmrFI CCNGG 1 cut(s) 76
BpmI CTGGAG 1 cut(s) 286
BpuEI CTTGAG 1 cut(s) 4
Bsc4I CCNNNNNNNGG 1 cut(s) 215
Bse1I ACTGG 1 cut(s) 303
BseBI CCWGG 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 215
BseNI ACTGG 1 cut(s) 303
BslFI GGGAC 1 cut(s) 332
BslI CCNNNNNNNGG 1 cut(s) 215
BsmAI GTCTC 1 cut(s) 249
BsmFI GGGAC 1 cut(s) 332
Bsp143I GATC 1 cut(s) 23
BspLI GGNNCC 2 cut(s) 80, 320
BspPI GGATC 1 cut(s) 18
BsrI ACTGG 1 cut(s) 303
BssMI GATC 1 cut(s) 23
BssSI CACGAG 1 cut(s) 246
Bst2BI CACGAG 1 cut(s) 246
Bst2UI CCWGG 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 12
BstKTI GATC 1 cut(s) 26
BstMAI GTCTC 1 cut(s) 249
BstMBI GATC 1 cut(s) 23
BstNI CCWGG 1 cut(s) 76
BstSCI CCNGG 1 cut(s) 74
BstX2I RGATCY 1 cut(s) 23
BstYI RGATCY 1 cut(s) 23
BtsIMutI CAGTG 1 cut(s) 310
Cac8I GCNNGC 1 cut(s) 12
Cfr13I GGNCC 2 cut(s) 78, 319
CviAII CATG 3 cut(s) 289, 315, 323
CviJI RGCY 4 cut(s) 98, 110, 205, 309
CviKI_1 RGCY 4 cut(s) 98, 110, 205, 309
DpnI GATC 1 cut(s) 25
DpnII GATC 1 cut(s) 23
Eco47I GGWCC 2 cut(s) 78, 319
EcoRII CCWGG 1 cut(s) 74
FaeI CATG 3 cut(s) 292, 318, 326
FaiI YATR 6 cut(s) 139, 194, 290, 316, 324, 360
FaqI GGGAC 1 cut(s) 332
FatI CATG 3 cut(s) 288, 314, 322
FspBI CTAG 2 cut(s) 36, 101
GsuI CTGGAG 1 cut(s) 286
Hin1II CATG 3 cut(s) 292, 318, 326
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HinfI GANTC 3 cut(s) 156, 229, 242
Hpy166II GTNNAC 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 286
Hpy188III TCNNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 136
HpyCH4V TGCA 2 cut(s) 10, 278
Hsp92II CATG 3 cut(s) 292, 318, 326
Kzo9I GATC 1 cut(s) 23
LpnPI CCDG 5 cut(s) 61, 88, 117, 150, 316
MaeI CTAG 2 cut(s) 36, 101
MalI GATC 1 cut(s) 25
MboI GATC 1 cut(s) 23
MboII GAAGA 2 cut(s) 57, 101
MflI RGATCY 1 cut(s) 23
MluCI AATT 2 cut(s) 189, 211
MlyI GAGTC 1 cut(s) 251
MnlI CCTC 2 cut(s) 37, 100
MseI TTAA 3 cut(s) 221, 252, 372
MspR9I CCNGG 1 cut(s) 76
MvaI CCWGG 1 cut(s) 76
NdeII GATC 1 cut(s) 23
NlaIII CATG 3 cut(s) 292, 318, 326
NlaIV GGNNCC 2 cut(s) 80, 320
PfeI GAWTC 2 cut(s) 156, 229
PflMI CCANNNNNTGG 1 cut(s) 215
PleI GAGTC 1 cut(s) 250
PpsI GAGTC 1 cut(s) 250
Psp6I CCWGG 1 cut(s) 74
PspGI CCWGG 1 cut(s) 74
PspN4I GGNNCC 2 cut(s) 80, 320
PspPI GGNCC 2 cut(s) 78, 319
PsuI RGATCY 1 cut(s) 23
SaqAI TTAA 3 cut(s) 221, 252, 372
Sau3AI GATC 1 cut(s) 23
Sau96I GGNCC 2 cut(s) 78, 319
SchI GAGTC 1 cut(s) 251
ScrFI CCNGG 1 cut(s) 76
SetI ASST 4 cut(s) 77, 100, 147, 207
SinI GGWCC 2 cut(s) 78, 319
SmlI CTYRAG 1 cut(s) 19
SmoI CTYRAG 1 cut(s) 19
Sse9I AATT 2 cut(s) 189, 211
SspMI CTAG 2 cut(s) 36, 101
StyD4I CCNGG 1 cut(s) 74
TasI AATT 2 cut(s) 189, 211
TfiI GAWTC 2 cut(s) 156, 229
Tru1I TTAA 3 cut(s) 221, 252, 372
Tru9I TTAA 3 cut(s) 221, 252, 372
TscAI CASTG 1 cut(s) 310
TspDTI ATGAA 1 cut(s) 339
TspRI CASTG 1 cut(s) 310
Van91I CCANNNNNTGG 1 cut(s) 215
VpaK11BI GGWCC 2 cut(s) 78, 319
XcmI CCANNNNNNNNNTGG 1 cut(s) 72
XspI CTAG 2 cut(s) 36, 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.