Rroxscaffold_2G00137540

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001154
Physical Location & Seq
Reverse (-)
75358856 .. 75359440
585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00137540.1

Sequence Viewer

Length: 219 bp
ATGGCTAGCATACTTCGCTCCTTTGTGGATGTGACCAAGACACACTTGGAGACTATGAAAGAAGTACTTTTGAATGACCATGCAACATCTACAAAAAGAGGTAAACTTGTCGAAGAGCTTATGAAATTGAAGCATATGGAGAGCAAGTTATCATTCGTGCAATTGAGAAAAGGTCATGGTATCCTCATTCAGCTCTTGCAGATGTTCCCAGCAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.22

Weight (kDa)

9.77

Isoelectric Point (pI)

35.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 66
AgsI TTSAA 2 cut(s) 73, 130
AluBI AGCT 2 cut(s) 118, 193
AluI AGCT 2 cut(s) 118, 193
Alw26I GTCTC 1 cut(s) 44
ApeKI GCWGC 1 cut(s) 212
AsuNHI GCTAGC 1 cut(s) 5
BciVI GTATCC 1 cut(s) 191
BcoDI GTCTC 1 cut(s) 44
BfaI CTAG 1 cut(s) 6
BfuI GTATCC 1 cut(s) 191
BisI GCNGC 1 cut(s) 213
BlsI GCNGC 1 cut(s) 214
BmcAI AGTACT 1 cut(s) 66
BmtI GCTAGC 1 cut(s) 9
BsaXI ACNNNNNCTCC 2 cut(s) 131, 161
BseGI GGATG 1 cut(s) 34
BseYI CCCAGC 1 cut(s) 208
BsmAI GTCTC 1 cut(s) 44
BspOI GCTAGC 1 cut(s) 9
BspQI GCTCTTC 1 cut(s) 108
Bst6I CTCTTC 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 7
BstF5I GGATG 1 cut(s) 34
BstMAI GTCTC 1 cut(s) 44
BstMWI GCNNNNNNNGC 1 cut(s) 15
BsuI GTATCC 1 cut(s) 191
BtsCI GGATG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 7
Csp6I GTAC 1 cut(s) 65
CviAII CATG 2 cut(s) 80, 176
CviJI RGCY 3 cut(s) 5, 118, 193
CviKI_1 RGCY 3 cut(s) 5, 118, 193
CviQI GTAC 1 cut(s) 65
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
FaeI CATG 2 cut(s) 83, 179
FaiI YATR 8 cut(s) 11, 56, 81, 122, 135, 137, 177, 217
FalI AAGNNNNNCTT 4 cut(s) 29, 61, 51, 83
FatI CATG 2 cut(s) 79, 175
FauNDI CATATG 1 cut(s) 135
Fnu4HI GCNGC 1 cut(s) 213
FokI GGATG 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 213
FspBI CTAG 1 cut(s) 6
GluI GCNGC 1 cut(s) 213
GsaI CCCAGC 1 cut(s) 212
Hin1II CATG 2 cut(s) 83, 179
Hpy166II GTNNAC 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 104
HpyCH4V TGCA 3 cut(s) 83, 160, 199
HpyF10VI GCNNNNNNNGC 1 cut(s) 15
Hsp92II CATG 2 cut(s) 83, 179
LguI GCTCTTC 1 cut(s) 108
LmnI GCTCC 1 cut(s) 23
MaeI CTAG 1 cut(s) 6
MaeIII GTNAC 1 cut(s) 31
MboII GAAGA 1 cut(s) 125
MfeI CAATTG 1 cut(s) 161
MluCI AATT 2 cut(s) 125, 161
MnlI CCTC 2 cut(s) 92, 194
MunI CAATTG 1 cut(s) 161
MwoI GCNNNNNNNGC 1 cut(s) 15
NdeI CATATG 1 cut(s) 135
NheI GCTAGC 1 cut(s) 5
NlaIII CATG 2 cut(s) 83, 179
NmuCI GTSAC 1 cut(s) 31
PciSI GCTCTTC 1 cut(s) 108
PkrI GCNGC 1 cut(s) 214
PspFI CCCAGC 1 cut(s) 208
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
SapI GCTCTTC 1 cut(s) 108
SatI GCNGC 1 cut(s) 213
ScaI AGTACT 1 cut(s) 66
SetI ASST 4 cut(s) 103, 120, 175, 195
SgeI CNNG 9 cut(s) 18, 49, 58, 92, 119, 157, 169, 188, 208
Sse9I AATT 2 cut(s) 125, 161
SspMI CTAG 1 cut(s) 6
TaqI TCGA 1 cut(s) 111
TasI AATT 2 cut(s) 125, 161
TatI WGTACW 1 cut(s) 64
TseFI GTSAC 1 cut(s) 31
TseI GCWGC 1 cut(s) 212
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 2 cut(s) 71, 137
XcmI CCANNNNNNNNNTGG 1 cut(s) 43
XspI CTAG 1 cut(s) 6
ZrmI AGTACT 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.