Rroxscaffold_2G00137550
MYB Family

nuclease HARBI1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0001154
Physical Location & Seq
Reverse (-)
75359474 .. 75359734
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00137550.1

Sequence Viewer

Length: 261 bp
ATGTTGTATATGACAGTTCACAAGGAAGCCAAAGGACTAAGACTTAAACCATTCATTCATTATGATAGTTTGGTGGAAGCTTTTGGGAGAGATAGAGCCAATGGGTTTGGAGCTGAAGGACCTGCTGAAGCGGATGAAGATTTGAATAATGATAATGAATTTGTTGATCTTGATGGAGATGGTTTGCCTGAAAATATTGTTCCTATACCTGCTACTCGTACAACTTCTTCTGCTTCCAATTCAACTAGGACTAGAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

86

Amino Acids

9.45

Weight (kDa)

4.85

Isoelectric Point (pI)

43.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 130, 217
AciI CCGC 1 cut(s) 131
AcsI RAATTY 1 cut(s) 158
AcuI CTGAAG 2 cut(s) 135, 147
AfaI GTAC 1 cut(s) 220
AgsI TTSAA 2 cut(s) 145, 243
AluBI AGCT 2 cut(s) 80, 113
AluI AGCT 2 cut(s) 80, 113
ApoI RAATTY 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 119
AvaII GGWCC 1 cut(s) 119
BarI GAAGNNNNNNTAC 2 cut(s) 211, 243
BccI CCATC 2 cut(s) 167, 173
BfaI CTAG 2 cut(s) 246, 252
BfuAI ACCTGC 2 cut(s) 130, 217
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BseGI GGATG 1 cut(s) 139
Bsp143I GATC 1 cut(s) 166
BspACI CCGC 1 cut(s) 131
BspMI ACCTGC 2 cut(s) 130, 217
BssMI GATC 1 cut(s) 166
Bst4CI ACNGT 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 38
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BtsCI GGATG 1 cut(s) 139
BveI ACCTGC 2 cut(s) 130, 217
Cfr13I GGNCC 1 cut(s) 119
Csp6I GTAC 1 cut(s) 219
CviJI RGCY 4 cut(s) 29, 80, 98, 113
CviKI_1 RGCY 4 cut(s) 29, 80, 98, 113
CviQI GTAC 1 cut(s) 219
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eco47I GGWCC 1 cut(s) 119
Eco57I CTGAAG 2 cut(s) 135, 147
EcoO109I RGGNCCY 1 cut(s) 119
FaiI YATR 4 cut(s) 9, 11, 63, 206
FokI GGATG 1 cut(s) 146
FspBI CTAG 2 cut(s) 246, 252
HindIII AAGCTT 1 cut(s) 78
Hpy166II GTNNAC 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 16
HpyF3I CTNAG 1 cut(s) 38
Kzo9I GATC 1 cut(s) 166
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 3 cut(s) 135, 201, 222
MaeI CTAG 2 cut(s) 246, 252
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 2 cut(s) 149, 219
MluCI AATT 2 cut(s) 158, 238
MseI TTAA 1 cut(s) 45
NdeII GATC 1 cut(s) 166
PpuMI RGGWCCY 1 cut(s) 119
Psp5II RGGWCCY 1 cut(s) 119
PspPI GGNCC 1 cut(s) 119
PspPPI RGGWCCY 1 cut(s) 119
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
SaqAI TTAA 1 cut(s) 45
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 119
SetI ASST 4 cut(s) 82, 115, 124, 211
SgeI CNNG 6 cut(s) 34, 134, 182, 200, 221, 228
SinI GGWCC 1 cut(s) 119
Sse9I AATT 2 cut(s) 158, 238
SsiI CCGC 1 cut(s) 131
SspI AATATT 1 cut(s) 196
SspMI CTAG 2 cut(s) 246, 252
TaaI ACNGT 1 cut(s) 16
TasI AATT 2 cut(s) 158, 238
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TspDTI ATGAA 4 cut(s) 43, 47, 150, 171
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 1 cut(s) 158
XspI CTAG 2 cut(s) 246, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.