Prupe.5G143900_v2.0.a1

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Reverse (-)
13294928 .. 13295387
460 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G143900.1

Sequence Viewer

Length: 402 bp
ATGATATGGAAATCTATTTTGTGGGGTCGTGTGGTTATTGAGGATGGTCTGATTTGGAGGGTGGGCAATGGAGCTTCTATCCGTATTTTCCAAGATAGGTGGATTCCAAAACCATTTACTTTCAAGCCGTTGTTGGCTAGAGGGCTGGATTGGAATACTACAGTCTCTGACCTTCTAACTGCTTCTGGTTCATGGGATTTACCTTTGTTAGAGCAACATTTTAGCTTGGAAGATCAAGATATTATTTCTAGCATCGCCTTGGGATCAGTCTCACAGCAGGGGGATAGCAAATATTGGTTTTTCTCAAAGAACGGGAAATATACCGTTAATACTGGGTATCGTGTCGCGGTTTTTGGATGCGAATTTGGAAGCTTGCAGTCCCCAACAAAATTAAAATGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

15.05

Weight (kDa)

8.62

Isoelectric Point (pI)

31.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 347
AciI CCGC 1 cut(s) 347
AclWI GGATC 1 cut(s) 271
AcsI RAATTY 1 cut(s) 362
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 3 cut(s) 74, 225, 372
AluI AGCT 3 cut(s) 74, 225, 372
Alw26I GTCTC 2 cut(s) 169, 274
AlwI GGATC 1 cut(s) 271
AlwNI CAGNNNCTG 1 cut(s) 167
ApoI RAATTY 1 cut(s) 362
BccI CCATC 1 cut(s) 38
BceAI ACGGC 1 cut(s) 112
BcoDI GTCTC 2 cut(s) 169, 274
BfaI CTAG 2 cut(s) 138, 249
BfmI CTRYAG 1 cut(s) 159
BmrI ACTGGG 1 cut(s) 342
BmsI GCATC 2 cut(s) 261, 347
BmuI ACTGGG 1 cut(s) 342
BsaJI CCNNGG 1 cut(s) 258
Bse1I ACTGG 1 cut(s) 337
Bse3DI GCAATG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 258
BseGI GGATG 2 cut(s) 49, 362
BseMI GCAATG 1 cut(s) 73
BseNI ACTGG 1 cut(s) 337
Bsh1236I CGCG 1 cut(s) 347
BslFI GGGAC 1 cut(s) 364
BsmAI GTCTC 2 cut(s) 169, 274
BsmFI GGGAC 1 cut(s) 364
Bsp143I GATC 2 cut(s) 232, 263
BspACI CCGC 1 cut(s) 347
BspFNI CGCG 1 cut(s) 347
BspPI GGATC 1 cut(s) 271
BsrDI GCAATG 1 cut(s) 73
BsrI ACTGG 1 cut(s) 337
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 2 cut(s) 232, 263
BssT1I CCWWGG 1 cut(s) 258
Bst4CI ACNGT 2 cut(s) 163, 325
BstC8I GCNNGC 1 cut(s) 374
BstF5I GGATG 2 cut(s) 49, 362
BstFNI CGCG 1 cut(s) 347
BstKTI GATC 2 cut(s) 235, 266
BstMAI GTCTC 2 cut(s) 169, 274
BstMBI GATC 2 cut(s) 232, 263
BstSFI CTRYAG 1 cut(s) 159
BstUI CGCG 1 cut(s) 347
BtgZI GCGATG 1 cut(s) 238
BtsCI GGATG 2 cut(s) 49, 362
Cac8I GCNNGC 1 cut(s) 374
CaiI CAGNNNCTG 1 cut(s) 167
CspCI CAANNNNNGTGG 2 cut(s) 80, 115
CviAII CATG 1 cut(s) 192
CviJI RGCY 6 cut(s) 74, 127, 137, 145, 225, 372
CviKI_1 RGCY 6 cut(s) 74, 127, 137, 145, 225, 372
DpnI GATC 2 cut(s) 234, 265
DpnII GATC 2 cut(s) 232, 263
Eco130I CCWWGG 1 cut(s) 258
EcoT14I CCWWGG 1 cut(s) 258
ErhI CCWWGG 1 cut(s) 258
FaeI CATG 1 cut(s) 195
FaiI YATR 3 cut(s) 7, 193, 321
FaqI GGGAC 1 cut(s) 364
FatI CATG 1 cut(s) 191
FokI GGATG 2 cut(s) 56, 369
FspBI CTAG 2 cut(s) 138, 249
Hin1II CATG 1 cut(s) 195
HindIII AAGCTT 1 cut(s) 370
HinfI GANTC 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 51, 169
Hpy188III TCNNGA 1 cut(s) 236
HpyAV CCTTC 1 cut(s) 182
HpyCH4III ACNGT 2 cut(s) 163, 325
HpyCH4V TGCA 1 cut(s) 376
Hsp92II CATG 1 cut(s) 195
Kzo9I GATC 2 cut(s) 232, 263
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 4 cut(s) 131, 171, 263, 318
LweI GCATC 2 cut(s) 261, 347
MaeI CTAG 2 cut(s) 138, 249
MalI GATC 2 cut(s) 234, 265
MboI GATC 2 cut(s) 232, 263
MboII GAAGA 1 cut(s) 242
MluCI AATT 2 cut(s) 362, 389
MnlI CCTC 3 cut(s) 34, 51, 134
MseI TTAA 2 cut(s) 327, 392
MvnI CGCG 1 cut(s) 347
NdeII GATC 2 cut(s) 232, 263
NlaIII CATG 1 cut(s) 195
PfeI GAWTC 1 cut(s) 103
PstNI CAGNNNCTG 1 cut(s) 167
SaqAI TTAA 2 cut(s) 327, 392
Sau3AI GATC 2 cut(s) 232, 263
SetI ASST 6 cut(s) 76, 101, 174, 205, 227, 374
SfaNI GCATC 2 cut(s) 261, 347
SfcI CTRYAG 1 cut(s) 159
Sse9I AATT 2 cut(s) 362, 389
SsiI CCGC 1 cut(s) 347
SspI AATATT 1 cut(s) 293
SspMI CTAG 2 cut(s) 138, 249
StyI CCWWGG 1 cut(s) 258
TaaI ACNGT 2 cut(s) 163, 325
TasI AATT 2 cut(s) 362, 389
TfiI GAWTC 1 cut(s) 103
Tru1I TTAA 2 cut(s) 327, 392
Tru9I TTAA 2 cut(s) 327, 392
TspDTI ATGAA 1 cut(s) 180
TspGWI ACGGA 1 cut(s) 71
XapI RAATTY 1 cut(s) 362
XspI CTAG 2 cut(s) 138, 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.