Rh2CG217800

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
21502026 .. 21502328
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG217800.1

Sequence Viewer

Length: 303 bp
ATGCGATGGAGAGTGGGTGATGGGACTCAAATCTTGCTAAAATCAGACAAGTGGATACCTCAACCCTTTACTTTTAAGGTTGTTTCCCCCATTAACTTGCCCAGGAATCCTATAGTTGCTGATCTTCTGTCCTCTAATGGTGAATGGAATGTGGATCTTATTCGGTGTCAGTTTCTTGAGTTTGAAGCTAAGACCATTCTATCTATTCCTCTAGCTAAACATGGTGGCCTGGATAGGATGATTTGGCACTACAACAAGAATGGACGATTTTCAGTAAAGTCGGGGTACTGGGTTGCTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.54

Weight (kDa)

9.73

Isoelectric Point (pI)

23.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 162
AfaI GTAC 1 cut(s) 287
AgsI TTSAA 1 cut(s) 185
AjnI CCWGG 2 cut(s) 101, 228
AluBI AGCT 2 cut(s) 188, 215
AluI AGCT 2 cut(s) 188, 215
AlwI GGATC 1 cut(s) 162
AoxI GGCC 1 cut(s) 226
AsuHPI GGTGA 2 cut(s) 29, 152
BccI CCATC 1 cut(s) 14
BciT130I CCWGG 2 cut(s) 103, 230
BciVI GTATCC 1 cut(s) 48
BfaI CTAG 1 cut(s) 212
BfmI CTRYAG 1 cut(s) 111
BfuI GTATCC 1 cut(s) 48
Bme1390I CCNGG 2 cut(s) 103, 230
BmrFI CCNGG 2 cut(s) 103, 230
BmrI ACTGGG 1 cut(s) 298
BmuI ACTGGG 1 cut(s) 298
BpuEI CTTGAG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 101
BsaXI ACNNNNNCTCC 1 cut(s) 31
Bse1I ACTGG 1 cut(s) 293
BseBI CCWGG 2 cut(s) 103, 230
BseDI CCNNGG 1 cut(s) 101
BseGI GGATG 1 cut(s) 243
BseNI ACTGG 1 cut(s) 293
BshFI GGCC 1 cut(s) 228
BslFI GGGAC 1 cut(s) 37
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 1 cut(s) 228
Bsp143I GATC 2 cut(s) 121, 154
BspANI GGCC 1 cut(s) 228
BspPI GGATC 1 cut(s) 162
BsrI ACTGG 1 cut(s) 293
BssECI CCNNGG 1 cut(s) 101
BssMI GATC 2 cut(s) 121, 154
Bst2UI CCWGG 2 cut(s) 103, 230
BstDEI CTNAG 1 cut(s) 189
BstF5I GGATG 1 cut(s) 243
BstKTI GATC 2 cut(s) 124, 157
BstMBI GATC 2 cut(s) 121, 154
BstNI CCWGG 2 cut(s) 103, 230
BstSCI CCNGG 2 cut(s) 101, 228
BstSFI CTRYAG 1 cut(s) 111
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BsuI GTATCC 1 cut(s) 48
BsuRI GGCC 1 cut(s) 228
BtgZI GCGATG 1 cut(s) 19
BtsCI GGATG 1 cut(s) 243
Csp6I GTAC 1 cut(s) 286
CviAII CATG 1 cut(s) 221
CviJI RGCY 3 cut(s) 188, 215, 228
CviKI_1 RGCY 3 cut(s) 188, 215, 228
CviQI GTAC 1 cut(s) 286
DdeI CTNAG 1 cut(s) 189
DpnI GATC 2 cut(s) 123, 156
DpnII GATC 2 cut(s) 121, 154
EcoRII CCWGG 2 cut(s) 101, 228
FaeI CATG 1 cut(s) 224
FaiI YATR 2 cut(s) 113, 222
FaqI GGGAC 1 cut(s) 37
FatI CATG 1 cut(s) 220
FokI GGATG 1 cut(s) 250
FspBI CTAG 1 cut(s) 212
HaeIII GGCC 1 cut(s) 228
Hin1II CATG 1 cut(s) 224
HinfI GANTC 2 cut(s) 25, 106
HphI GGTGA 2 cut(s) 29, 152
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 189
Hsp92II CATG 1 cut(s) 224
Kzo9I GATC 2 cut(s) 121, 154
LpnPI CCDG 5 cut(s) 88, 115, 215, 242, 274
MaeI CTAG 1 cut(s) 212
MalI GATC 2 cut(s) 123, 156
MboI GATC 2 cut(s) 121, 154
MboII GAAGA 1 cut(s) 116
MflI RGATCY 1 cut(s) 154
MluCI AATT 1 cut(s) 298
MlyI GAGTC 1 cut(s) 19
MnlI CCTC 3 cut(s) 69, 142, 219
MseI TTAA 3 cut(s) 75, 93, 301
MspR9I CCNGG 2 cut(s) 103, 230
MvaI CCWGG 2 cut(s) 103, 230
NdeII GATC 2 cut(s) 121, 154
NlaIII CATG 1 cut(s) 224
PfeI GAWTC 1 cut(s) 106
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
Psp6I CCWGG 2 cut(s) 101, 228
PspGI CCWGG 2 cut(s) 101, 228
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 1 cut(s) 287
RsaNI GTAC 1 cut(s) 286
SaqAI TTAA 3 cut(s) 75, 93, 301
Sau3AI GATC 2 cut(s) 121, 154
SchI GAGTC 1 cut(s) 19
ScrFI CCNGG 2 cut(s) 103, 230
SetI ASST 4 cut(s) 61, 81, 190, 217
SfcI CTRYAG 1 cut(s) 111
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 1 cut(s) 298
SspMI CTAG 1 cut(s) 212
StyD4I CCNGG 2 cut(s) 101, 228
TasI AATT 1 cut(s) 298
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 3 cut(s) 75, 93, 301
Tru9I TTAA 3 cut(s) 75, 93, 301
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.