Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028625.1

Orthogroup ID

OG0001470

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 530

Gene Structure 530 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028625.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 514 bp

atgtgcgttccaaagaaagagggaggtatgggatttagggagttacagaattttaataacgctctggttgctaaactagggtggagattaattggtgaagggaactctcttgtgggagaaatgttaaaggctcgctatttccctcgaagtttgtttttagaggctgaattggggtctaatccttctactatttggcgtgctattatatggggaaaggagttgcttgttaaaggattaaggtggagaatctgtaatggtcgtagtgtcagagtatttcaggatccatgggttccgagtattcaaggttttggtgtgacctggaaaccgggattggatttaaatatgcgagttgcggagctgatctcggaggaggggagttgggaggttcaacgcttggagcggattggcacatgtcaggaggtagaagctattcttgaaatacctctcactcgatttaatggtcaggatagaatgatctggaataataacaagtatgggaagttttcagtgaaga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3

Protein Analysis

171

Amino Acids

19.61

Weight (kDa)

9.47

Isoelectric Point (pI)

24.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001470)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATMG00310
fragaria_vesca	FvH4_1g30140 FvH4_3g05951 FvH4_3g07263 FvH4_4g08371 FvH4_4g17922 FvH4_5g08581 FvH4_6g37191
malus_domestica	MD08G1177900.v1.1
prunus_persica	Prupe.1G197300_v2.0.a1 Prupe.3G181300_v2.0.a1 Prupe.4G011200_v2.0.a1 Prupe.5G143900_v2.0.a1 Prupe.6G123900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0324011 RchiOBHm_Chr1g0349051 RchiOBHm_Chr5g0012551 RchiOBHm_Chr7g0182091
rosa_laevigata	RLG00000016534
rosa_multiflora	Rmu_co8418073.1_g000001 Rmu_co8492163.1_g000001 Rmu_sc0000131.1_g000007 Rmu_sc0000464.1_g000010 Rmu_sc0002667.1_g000017 Rmu_sc0003052.1_g000009 Rmu_sc0003124.1_g000011 Rmu_sc0004373.1_g000011 Rmu_sc0004823.1_g000011 Rmu_sc0005279.1_g000003 Rmu_sc0005307.1_g000012 Rmu_sc0005640.1_g000003 Rmu_sc0005933.1_g000002 Rmu_sc0013078.1_g000008 Rmu_sc0013453.1_g000003 Rmu_sc0014005.1_g000004 Rmu_sc0028625.1_g000001 Rmu_ssc0000267.1_g000010 Rmu_ssc0000342.1_g000022 Rmu_ssc0000421.1_g000082
rosa_roxburghii	Rroxscaffold_3G00252810 Rroxscaffold_6G00406990 Rroxscaffold_6G00410800
rosa_rugosa	Rorug02G0379900 Rorug03G0263800 Rorug05G0089800
rosa_samantha	Rh1AG217300 Rh1CG201700 Rh2BG225700 Rh2CG217800 Rh3BG268500
rosa_wichuraiana	Rw0G021950

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	400
AciI	CCGC	2 cut(s)	353, 400
AclWI	GGATC	2 cut(s)	275, 288
AcsI	RAATTY	1 cut(s)	49
AflIII	ACRYGT	1 cut(s)	410
AgsI	TTSAA	3 cut(s)	302, 389, 437
AjnI	CCWGG	1 cut(s)	317
AjuI	GAANNNNNNNTTGG	2 cut(s)	314, 346
AluBI	AGCT	2 cut(s)	358, 428
AluI	AGCT	2 cut(s)	358, 428
AlwI	GGATC	2 cut(s)	275, 288
ApoI	RAATTY	1 cut(s)	49
AseI	ATTAAT	1 cut(s)	89
Asp700I	GAANNNNTTC	1 cut(s)	429
AsuC2I	CCSGG	1 cut(s)	327
AsuHPI	GGTGA	1 cut(s)	107
BamHI	GGATCC	1 cut(s)	280
BciT130I	CCWGG	1 cut(s)	319
BcnI	CCSGG	1 cut(s)	327
BfaI	CTAG	1 cut(s)	77
Bme1390I	CCNGG	2 cut(s)	319, 327
BmiI	GGNNCC	2 cut(s)	282, 291
BmrFI	CCNGG	2 cut(s)	319, 327
BplI	GAGNNNNNCTC	2 cut(s)	347, 379
BpuMI	CCSGG	1 cut(s)	327
BsaJI	CCNNGG	1 cut(s)	284
BsaXI	ACNNNNNCTCC	2 cut(s)	235, 265
BseBI	CCWGG	1 cut(s)	319
BseDI	CCNNGG	1 cut(s)	284
BseRI	GAGGAG	1 cut(s)	383
BsiSI	CCGG	1 cut(s)	326
Bsp143I	GATC	3 cut(s)	280, 360, 474
Bsp19I	CCATGG	1 cut(s)	284
BspACI	CCGC	2 cut(s)	353, 400
BspLI	GGNNCC	2 cut(s)	282, 291
BspPI	GGATC	2 cut(s)	275, 288
BsrBI	CCGCTC	1 cut(s)	400
BssECI	CCNNGG	1 cut(s)	284
BssMI	GATC	3 cut(s)	280, 360, 474
BssT1I	CCWWGG	1 cut(s)	284
Bst2UI	CCWGG	1 cut(s)	319
BstC8I	GCNNGC	2 cut(s)	133, 198
BstDSI	CCRYGG	1 cut(s)	284
BstKTI	GATC	3 cut(s)	283, 363, 477
BstMBI	GATC	3 cut(s)	280, 360, 474
BstMWI	GCNNNNNNNGC	1 cut(s)	68
BstNI	CCWGG	1 cut(s)	319
BstNSI	RCATGY	1 cut(s)	414
BstSCI	CCNGG	2 cut(s)	317, 325
BstX2I	RGATCY	1 cut(s)	280
BstYI	RGATCY	1 cut(s)	280
BtgI	CCRYGG	1 cut(s)	284
BtsIMutI	CAGTG	1 cut(s)	513
Cac8I	GCNNGC	2 cut(s)	133, 198
CviAII	CATG	2 cut(s)	285, 411
CviJI	RGCY	4 cut(s)	131, 164, 358, 428
CviKI_1	RGCY	4 cut(s)	131, 164, 358, 428
DpnI	GATC	3 cut(s)	282, 362, 476
DpnII	GATC	3 cut(s)	280, 360, 474
DraI	TTTAAA	1 cut(s)	339
Eco130I	CCWWGG	1 cut(s)	284
EcoRII	CCWGG	1 cut(s)	317
EcoT14I	CCWWGG	1 cut(s)	284
ErhI	CCWWGG	1 cut(s)	284
FaeI	CATG	2 cut(s)	288, 414
FaiI	YATR	7 cut(s)	29, 206, 208, 286, 344, 412, 495
FalI	AAGNNNNNCTT	2 cut(s)	417, 449
FatI	CATG	2 cut(s)	284, 410
FspBI	CTAG	1 cut(s)	77
HapII	CCGG	1 cut(s)	326
Hin1II	CATG	2 cut(s)	288, 414
HinfI	GANTC	1 cut(s)	246
HpaII	CCGG	1 cut(s)	326
HphI	GGTGA	1 cut(s)	107
Hpy188I	TCNGA	3 cut(s)	269, 294, 367
Hpy188III	TCNNGA	5 cut(s)	278, 416, 434, 464, 478
HpyAV	CCTTC	2 cut(s)	92, 192
HpyF10VI	GCNNNNNNNGC	1 cut(s)	68
Hsp92II	CATG	2 cut(s)	288, 414
Kzo9I	GATC	3 cut(s)	280, 360, 474
LmnI	GCTCC	2 cut(s)	355, 397
LpnPI	CCDG	8 cut(s)	50, 263, 304, 331, 339, 401, 449, 463
MaeI	CTAG	1 cut(s)	77
MaeIII	GTNAC	2 cut(s)	42, 313
MalI	GATC	3 cut(s)	282, 362, 476
MbiI	CCGCTC	1 cut(s)	400
MboI	GATC	3 cut(s)	280, 360, 474
MflI	RGATCY	1 cut(s)	280
MluCI	AATT	3 cut(s)	49, 90, 167
MnlI	CCTC	9 cut(s)	13, 17, 153, 154, 361, 364, 376, 412, 453
MroXI	GAANNNNTTC	1 cut(s)	429
MseI	TTAA	7 cut(s)	54, 89, 125, 228, 236, 338, 456
MspI	CCGG	1 cut(s)	326
MspR9I	CCNGG	2 cut(s)	319, 327
MvaI	CCWGG	1 cut(s)	319
MwoI	GCNNNNNNNGC	1 cut(s)	68
NciI	CCSGG	1 cut(s)	327
NcoI	CCATGG	1 cut(s)	284
NdeII	GATC	3 cut(s)	280, 360, 474
NlaIII	CATG	2 cut(s)	288, 414
NlaIV	GGNNCC	2 cut(s)	282, 291
NmuCI	GTSAC	1 cut(s)	313
NspI	RCATGY	1 cut(s)	414
PciI	ACATGT	1 cut(s)	410
PdmI	GAANNNNTTC	1 cut(s)	429
PfeI	GAWTC	1 cut(s)	246
PscI	ACATGT	1 cut(s)	410
PshBI	ATTAAT	1 cut(s)	89
Psp6I	CCWGG	1 cut(s)	317
PspGI	CCWGG	1 cut(s)	317
PspN4I	GGNNCC	2 cut(s)	282, 291
PsuI	RGATCY	1 cut(s)	280
SaqAI	TTAA	7 cut(s)	54, 89, 125, 228, 236, 338, 456
Sau3AI	GATC	3 cut(s)	280, 360, 474
ScrFI	CCNGG	2 cut(s)	319, 327
SetI	ASST	9 cut(s)	28, 242, 307, 320, 360, 387, 423, 430, 445
SmiI	ATTTAAAT	1 cut(s)	339
Sse9I	AATT	3 cut(s)	49, 90, 167
SsiI	CCGC	2 cut(s)	353, 400
SspMI	CTAG	1 cut(s)	77
StyD4I	CCNGG	2 cut(s)	317, 325
StyI	CCWWGG	1 cut(s)	284
SwaI	ATTTAAAT	1 cut(s)	339
TaqI	TCGA	2 cut(s)	145, 451
TasI	AATT	3 cut(s)	49, 90, 167
TfiI	GAWTC	1 cut(s)	246
Tru1I	TTAA	7 cut(s)	54, 89, 125, 228, 236, 338, 456
Tru9I	TTAA	7 cut(s)	54, 89, 125, 228, 236, 338, 456
TscAI	CASTG	1 cut(s)	513
TseFI	GTSAC	1 cut(s)	313
Tsp45I	GTSAC	1 cut(s)	313
TspRI	CASTG	1 cut(s)	513
VspI	ATTAAT	1 cut(s)	89
XapI	RAATTY	1 cut(s)	49
XceI	RCATGY	1 cut(s)	414
XmnI	GAANNNNTTC	1 cut(s)	429
XspI	CTAG	1 cut(s)	77

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.