Rmu_ssc0000421.1_g000082

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000421.1
Physical Location & Seq
Forward (+)
296704 .. 297057
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000421.1_g000082.1.cds

Sequence Viewer

Length: 354 bp
atgctcagttttgagaaatcagcagtggctttcaattctcaagtgggggaagtagaacagtctgagtatagtggtcttctgcaaatgcctattgtgccattccatgaaagttatttgggactaccaacaatcgttgggaggaataagaagtctgctttcaagaaagtcaaggacaggttgcgtaagagagttacaaggtggaaagaaaatttgatgtctaaggcaggaaaattggttctactaaaatctgtggcacaagttattccctcatatgcaatgagtgtatttaaagttcctgtgacactttgtcaagagatggattctttaatgagcaatttctggtggagtggatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.29

Weight (kDa)

9.84

Isoelectric Point (pI)

50.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 208
AgsI TTSAA 2 cut(s) 34, 160
AhdI GACNNNNNGTC 1 cut(s) 306
AloI GAACNNNNNNTCC 2 cut(s) 219, 251
ApoI RAATTY 1 cut(s) 208
BbsI GAAGAC 1 cut(s) 68
BccI CCATC 1 cut(s) 310
BmeRI GACNNNNNGTC 1 cut(s) 306
BpiI GAAGAC 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 24
Bse3DI GCAATG 1 cut(s) 282
BseMI GCAATG 1 cut(s) 282
BseMII CTCAG 2 cut(s) 19, 54
BslFI GGGAC 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 132
BspCNI CTCAG 2 cut(s) 18, 55
BsrDI GCAATG 1 cut(s) 282
Bst4CI ACNGT 1 cut(s) 60
BstDEI CTNAG 3 cut(s) 5, 63, 219
BstMWI GCNNNNNNNGC 1 cut(s) 94
BstV2I GAAGAC 1 cut(s) 68
BtsI GCAGTG 1 cut(s) 30
BtsIMutI CAGTG 1 cut(s) 30
CviAII CATG 1 cut(s) 104
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DdeI CTNAG 3 cut(s) 5, 63, 219
DraI TTTAAA 1 cut(s) 289
DriI GACNNNNNGTC 1 cut(s) 306
Eam1105I GACNNNNNGTC 1 cut(s) 306
FaeI CATG 1 cut(s) 107
FaiI YATR 4 cut(s) 69, 105, 271, 273
FaqI GGGAC 1 cut(s) 132
FatI CATG 1 cut(s) 103
FauNDI CATATG 1 cut(s) 271
Hin1II CATG 1 cut(s) 107
HinfI GANTC 1 cut(s) 320
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 2 cut(s) 160, 311
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4V TGCA 2 cut(s) 82, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 94
HpyF3I CTNAG 3 cut(s) 5, 63, 219
Hsp92II CATG 1 cut(s) 107
LpnPI CCDG 4 cut(s) 160, 210, 309, 325
MaeIII GTNAC 2 cut(s) 190, 298
MboII GAAGA 1 cut(s) 68
MluCI AATT 4 cut(s) 34, 208, 230, 334
MnlI CCTC 2 cut(s) 132, 277
MseI TTAA 2 cut(s) 288, 326
MwoI GCNNNNNNNGC 1 cut(s) 94
NdeI CATATG 1 cut(s) 271
NlaIII CATG 1 cut(s) 107
NmuCI GTSAC 1 cut(s) 298
PfeI GAWTC 1 cut(s) 320
PsrI GAACNNNNNNTAC 2 cut(s) 276, 308
SaqAI TTAA 2 cut(s) 288, 326
SetI ASST 2 cut(s) 179, 200
SmlI CTYRAG 1 cut(s) 39
SmoI CTYRAG 1 cut(s) 39
Sse9I AATT 4 cut(s) 34, 208, 230, 334
TaaI ACNGT 1 cut(s) 60
TasI AATT 4 cut(s) 34, 208, 230, 334
TfiI GAWTC 1 cut(s) 320
Tru1I TTAA 2 cut(s) 288, 326
Tru9I TTAA 2 cut(s) 288, 326
TscAI CASTG 1 cut(s) 30
TseFI GTSAC 1 cut(s) 298
Tsp45I GTSAC 1 cut(s) 298
TspDTI ATGAA 1 cut(s) 120
TspRI CASTG 1 cut(s) 30
XapI RAATTY 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.