Rh2BG225700

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0001470
Physical Location & Seq
Reverse (-)
21951635 .. 21953430
1796 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG225700.1

Sequence Viewer

Length: 474 bp
ATGGTGGTTTGGGTTTTAGCTAAATCTTATTGGCACATTGTGCATGCTCCTCATTCCTTGGTTGGCAGATTACTGAAAGCAAAATATTTTTTGGAGACAGAATGGTTGACTGCTAGGTTGGGTAGAGGTGCATCTCTTGTTTGGAGGAGTCTTGTTTGGGGAAAAAAAATCCTAAAGCTTGGTATGCGATGGAGTGTGGGTGATGGGACTCAAATCTTTCTAAAATTAGACAAGTGGATACCTCAACCCTTTACTTTTAAGGTTGTTTCCCCCATTAACTTGCCCAGGAATCCTACAGTTGCGGATCTTCTGTCCTCTAATGGTGAATGGAATGTGGATCTTATTCGGTGTCAGTTTCTTGAGTTTGAAGCTAAGACCATTCTATTTATTCCTCTAGCTAAACATGGTGGCCTGGATAGGATGATTTGGCACTATAACAAGAATGGACGATTTTCGGTAAAGTCGGGGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

157

Amino Acids

18.16

Weight (kDa)

10.15

Isoelectric Point (pI)

22.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 302
AclWI GGATC 2 cut(s) 312, 345
AdeI CACNNNGTG 1 cut(s) 40
AfaI GTAC 1 cut(s) 470
AgsI TTSAA 1 cut(s) 368
AjnI CCWGG 2 cut(s) 284, 411
AluBI AGCT 4 cut(s) 20, 178, 371, 398
AluI AGCT 4 cut(s) 20, 178, 371, 398
Alw26I GTCTC 1 cut(s) 89
AlwI GGATC 2 cut(s) 312, 345
AoxI GGCC 1 cut(s) 409
AsuHPI GGTGA 2 cut(s) 212, 335
BccI CCATC 2 cut(s) 183, 197
BciT130I CCWGG 2 cut(s) 286, 413
BciVI GTATCC 1 cut(s) 231
BcoDI GTCTC 1 cut(s) 89
BfaI CTAG 3 cut(s) 114, 395, 472
BfmI CTRYAG 1 cut(s) 294
BfuI GTATCC 1 cut(s) 231
Bme1390I CCNGG 2 cut(s) 286, 413
BmrFI CCNGG 2 cut(s) 286, 413
BmsI GCATC 1 cut(s) 140
BpuEI CTTGAG 1 cut(s) 380
BsaJI CCNNGG 2 cut(s) 57, 284
BsaXI ACNNNNNCTCC 2 cut(s) 184, 214
BseBI CCWGG 2 cut(s) 286, 413
BseDI CCNNGG 2 cut(s) 57, 284
BseGI GGATG 1 cut(s) 426
BseRI GAGGAG 2 cut(s) 39, 160
BshFI GGCC 1 cut(s) 411
BslFI GGGAC 1 cut(s) 220
BsmAI GTCTC 1 cut(s) 89
BsmFI GGGAC 1 cut(s) 220
BsnI GGCC 1 cut(s) 411
Bsp143I GATC 2 cut(s) 304, 337
BspACI CCGC 1 cut(s) 302
BspANI GGCC 1 cut(s) 411
BspPI GGATC 2 cut(s) 312, 345
BssECI CCNNGG 2 cut(s) 57, 284
BssMI GATC 2 cut(s) 304, 337
BssT1I CCWWGG 1 cut(s) 57
Bst2UI CCWGG 2 cut(s) 286, 413
Bst4CI ACNGT 1 cut(s) 298
BstAPI GCANNNNNTGC 1 cut(s) 40
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 372
BstF5I GGATG 1 cut(s) 426
BstKTI GATC 2 cut(s) 307, 340
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 2 cut(s) 304, 337
BstMWI GCNNNNNNNGC 2 cut(s) 40, 184
BstNI CCWGG 2 cut(s) 286, 413
BstNSI RCATGY 1 cut(s) 47
BstSCI CCNGG 2 cut(s) 284, 411
BstSFI CTRYAG 1 cut(s) 294
BstX2I RGATCY 2 cut(s) 304, 337
BstYI RGATCY 2 cut(s) 304, 337
BsuI GTATCC 1 cut(s) 231
BsuRI GGCC 1 cut(s) 411
BtgZI GCGATG 1 cut(s) 202
BtsCI GGATG 1 cut(s) 426
Cac8I GCNNGC 1 cut(s) 45
Csp6I GTAC 1 cut(s) 469
CviAII CATG 2 cut(s) 44, 404
CviJI RGCY 5 cut(s) 20, 178, 371, 398, 411
CviKI_1 RGCY 5 cut(s) 20, 178, 371, 398, 411
CviQI GTAC 1 cut(s) 469
DdeI CTNAG 1 cut(s) 372
DpnI GATC 2 cut(s) 306, 339
DpnII GATC 2 cut(s) 304, 337
DraIII CACNNNGTG 1 cut(s) 40
Eco130I CCWWGG 1 cut(s) 57
EcoRII CCWGG 2 cut(s) 284, 411
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaeI CATG 2 cut(s) 47, 407
FaiI YATR 4 cut(s) 45, 185, 405, 435
FaqI GGGAC 1 cut(s) 220
FatI CATG 2 cut(s) 43, 403
FokI GGATG 1 cut(s) 433
FspBI CTAG 3 cut(s) 114, 395, 472
HaeIII GGCC 1 cut(s) 411
Hin1II CATG 2 cut(s) 47, 407
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HindIII AAGCTT 1 cut(s) 176
HinfI GANTC 3 cut(s) 148, 208, 289
HphI GGTGA 2 cut(s) 212, 335
Hpy166II GTNNAC 1 cut(s) 108
Hpy188III TCNNGA 1 cut(s) 359
Hpy8I GTNNAC 1 cut(s) 108
HpyCH4III ACNGT 1 cut(s) 298
HpyCH4V TGCA 2 cut(s) 43, 131
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 184
HpyF3I CTNAG 1 cut(s) 372
Hsp92II CATG 2 cut(s) 47, 407
Kzo9I GATC 2 cut(s) 304, 337
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 4 cut(s) 271, 298, 398, 425
LweI GCATC 1 cut(s) 140
MaeI CTAG 3 cut(s) 114, 395, 472
MalI GATC 2 cut(s) 306, 339
MboI GATC 2 cut(s) 304, 337
MboII GAAGA 1 cut(s) 299
MflI RGATCY 2 cut(s) 304, 337
MluCI AATT 1 cut(s) 224
MlyI GAGTC 2 cut(s) 157, 202
MnlI CCTC 6 cut(s) 60, 119, 138, 252, 325, 402
MseI TTAA 2 cut(s) 258, 276
MspR9I CCNGG 2 cut(s) 286, 413
MvaI CCWGG 2 cut(s) 286, 413
MwoI GCNNNNNNNGC 2 cut(s) 40, 184
NdeII GATC 2 cut(s) 304, 337
NlaIII CATG 2 cut(s) 47, 407
NspI RCATGY 1 cut(s) 47
PaeI GCATGC 1 cut(s) 47
PfeI GAWTC 1 cut(s) 289
PleI GAGTC 2 cut(s) 156, 202
PpsI GAGTC 2 cut(s) 156, 202
Psp6I CCWGG 2 cut(s) 284, 411
PspGI CCWGG 2 cut(s) 284, 411
PsuI RGATCY 2 cut(s) 304, 337
RsaI GTAC 1 cut(s) 470
RsaNI GTAC 1 cut(s) 469
SaqAI TTAA 2 cut(s) 258, 276
Sau3AI GATC 2 cut(s) 304, 337
SchI GAGTC 2 cut(s) 157, 202
ScrFI CCNGG 2 cut(s) 286, 413
SetI ASST 8 cut(s) 22, 119, 130, 180, 244, 264, 373, 400
SfaNI GCATC 1 cut(s) 140
SfcI CTRYAG 1 cut(s) 294
SmlI CTYRAG 1 cut(s) 359
SmoI CTYRAG 1 cut(s) 359
SphI GCATGC 1 cut(s) 47
Sse9I AATT 1 cut(s) 224
SsiI CCGC 1 cut(s) 302
SspI AATATT 1 cut(s) 86
SspMI CTAG 3 cut(s) 114, 395, 472
StyD4I CCNGG 2 cut(s) 284, 411
StyI CCWWGG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 298
TasI AATT 1 cut(s) 224
TfiI GAWTC 1 cut(s) 289
Tru1I TTAA 2 cut(s) 258, 276
Tru9I TTAA 2 cut(s) 258, 276
XceI RCATGY 1 cut(s) 47
XspI CTAG 3 cut(s) 114, 395, 472
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.