Rmu_sc0000131.1_g000007

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000131.1
OG0001470
Physical Location & Seq
Forward (+)
25152 .. 25943
792 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000131.1_g000007.1.cds

Sequence Viewer

Length: 792 bp
atggtcagttttgagaaattagcggtggctttcaattctcaagtgggggaagtagaacagtctgagtatagtggtcttctgcaaattcctattgtgccattccatgaaagttatttgggactaccaacaatcgttgggaggaataagaagtctactttcaagaaagttaaggacaggttgtgtaagagagttacagggtggaaagaaaatttgatgtctaaggcaggaaaattggttctactaaaatctgtggcacaagctattccctcatatacaatgagtgtatttaaagtttctgtgacactttatcaagagatggattcttttatgagcaatttctggtggagtggatcgaaaagttcaaggggattgcattggttgaactggaaatcagtttgtgcctcgaagaagaagggaggtttgggacttagaaacattagtttgtttaaccaagccttactagctaaacaagtatggagattggtccatgatgaacgaagcttagtgtccagagtgatgaaagcaaaatatttccctacttcaagtttgttgctagcgaacaaaggcaaggatacttcttacacatggaggtcacttatgtggggtagggaattattatggaggggtatccgtcagcggattggaaatggagaaactacggggatttatagtcacccatggataccgagacccgtaaatttcaaaccgtacactccgacaagtgtggcattggataccctggtaagctttttgatgtcgggggcaggaggatggaatgaagcctttatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

263

Amino Acids

29.81

Weight (kDa)

10.14

Isoelectric Point (pI)

30.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 152
AciI CCGC 2 cut(s) 23, 637
AclWI GGATC 1 cut(s) 358
AcsI RAATTY 3 cut(s) 84, 208, 697
AfaI GTAC 1 cut(s) 710
AgsI TTSAA 6 cut(s) 34, 160, 363, 382, 543, 703
AjnI CCWGG 1 cut(s) 738
AjuI GAANNNNNNNTTGG 2 cut(s) 404, 436
AleI CACNNNNGTG 1 cut(s) 598
AloI GAACNNNNNNTCC 2 cut(s) 219, 251
AluBI AGCT 4 cut(s) 260, 464, 501, 747
AluI AGCT 4 cut(s) 260, 464, 501, 747
Alw26I GTCTC 1 cut(s) 682
AlwI GGATC 1 cut(s) 358
ApoI RAATTY 3 cut(s) 84, 208, 697
AspS9I GGNCC 1 cut(s) 484
AsuHPI GGTGA 1 cut(s) 665
AsuNHI GCTAGC 1 cut(s) 553
AvaII GGWCC 1 cut(s) 484
BaeI ACNNNNGTAYC 2 cut(s) 726, 759
BbsI GAAGAC 1 cut(s) 68
BccI CCATC 2 cut(s) 310, 765
BciT130I CCWGG 1 cut(s) 740
BciVI GTATCC 4 cut(s) 565, 638, 675, 727
BcoDI GTCTC 1 cut(s) 682
BfaI CTAG 2 cut(s) 461, 554
BfuI GTATCC 4 cut(s) 565, 638, 675, 727
Bme1390I CCNGG 1 cut(s) 740
Bme18I GGWCC 1 cut(s) 484
BmgT120I GGNCC 1 cut(s) 484
BmrFI CCNGG 1 cut(s) 740
BmtI GCTAGC 1 cut(s) 557
BpiI GAAGAC 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 24
BsaI GGTCTC 1 cut(s) 682
BsaJI CCNNGG 2 cut(s) 677, 738
Bse1I ACTGG 1 cut(s) 389
BseBI CCWGG 1 cut(s) 740
BseDI CCNNGG 2 cut(s) 677, 738
BseGI GGATG 1 cut(s) 776
BseMII CTCAG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 389
BslFI GGGAC 2 cut(s) 132, 438
BsmAI GTCTC 1 cut(s) 682
BsmFI GGGAC 2 cut(s) 132, 438
Bso31I GGTCTC 1 cut(s) 682
Bsp143I GATC 1 cut(s) 350
Bsp19I CCATGG 1 cut(s) 677
BspACI CCGC 2 cut(s) 23, 637
BspCNI CTCAG 1 cut(s) 55
BspOI GCTAGC 1 cut(s) 557
BspPI GGATC 1 cut(s) 358
BspTNI GGTCTC 1 cut(s) 682
BsrI ACTGG 1 cut(s) 389
BssECI CCNNGG 2 cut(s) 677, 738
BssMI GATC 1 cut(s) 350
BssT1I CCWWGG 1 cut(s) 677
Bst2UI CCWGG 1 cut(s) 740
Bst4CI ACNGT 2 cut(s) 60, 708
BstC8I GCNNGC 1 cut(s) 555
BstDEI CTNAG 4 cut(s) 63, 219, 428, 502
BstDSI CCRYGG 1 cut(s) 677
BstF5I GGATG 1 cut(s) 776
BstKTI GATC 1 cut(s) 353
BstMAI GTCTC 1 cut(s) 682
BstMBI GATC 1 cut(s) 350
BstMWI GCNNNNNNNGC 1 cut(s) 461
BstNI CCWGG 1 cut(s) 740
BstSCI CCNGG 1 cut(s) 738
BstV2I GAAGAC 1 cut(s) 68
BsuI GTATCC 4 cut(s) 565, 638, 675, 727
BtgI CCRYGG 1 cut(s) 677
BtsCI GGATG 1 cut(s) 776
Cac8I GCNNGC 1 cut(s) 555
Cfr13I GGNCC 1 cut(s) 484
Csp6I GTAC 1 cut(s) 709
CviAII CATG 4 cut(s) 104, 488, 585, 678
CviJI RGCY 7 cut(s) 29, 260, 455, 464, 501, 747, 782
CviKI_1 RGCY 7 cut(s) 29, 260, 455, 464, 501, 747, 782
CviQI GTAC 1 cut(s) 709
DdeI CTNAG 4 cut(s) 63, 219, 428, 502
DpnI GATC 1 cut(s) 352
DpnII GATC 1 cut(s) 350
DraI TTTAAA 1 cut(s) 289
Eco130I CCWWGG 1 cut(s) 677
Eco31I GGTCTC 1 cut(s) 682
Eco47I GGWCC 1 cut(s) 484
EcoRII CCWGG 1 cut(s) 738
EcoT14I CCWWGG 1 cut(s) 677
ErhI CCWWGG 1 cut(s) 677
FaeI CATG 4 cut(s) 107, 491, 588, 681
FaqI GGGAC 2 cut(s) 132, 438
FatI CATG 4 cut(s) 103, 487, 584, 677
FblI GTMKAC 1 cut(s) 152
FokI GGATG 1 cut(s) 783
FspBI CTAG 2 cut(s) 461, 554
Hin1II CATG 4 cut(s) 107, 491, 588, 681
HindIII AAGCTT 2 cut(s) 499, 745
HinfI GANTC 1 cut(s) 320
HphI GGTGA 1 cut(s) 665
Hpy166II GTNNAC 2 cut(s) 153, 711
Hpy188I TCNGA 3 cut(s) 64, 717, 791
Hpy188III TCNNGA 3 cut(s) 160, 311, 510
Hpy8I GTNNAC 2 cut(s) 153, 711
HpyAV CCTTC 1 cut(s) 406
HpyCH4III ACNGT 2 cut(s) 60, 708
HpyCH4V TGCA 2 cut(s) 82, 373
HpyF10VI GCNNNNNNNGC 1 cut(s) 461
HpyF3I CTNAG 4 cut(s) 63, 219, 428, 502
Hsp92II CATG 4 cut(s) 107, 491, 588, 681
Kzo9I GATC 1 cut(s) 350
LpnPI CCDG 9 cut(s) 160, 180, 210, 325, 370, 523, 725, 750, 752
MaeI CTAG 2 cut(s) 461, 554
MaeIII GTNAC 4 cut(s) 190, 298, 591, 671
MalI GATC 1 cut(s) 352
MboI GATC 1 cut(s) 350
MboII GAAGA 3 cut(s) 68, 418, 421
MluCI AATT 8 cut(s) 17, 34, 84, 208, 230, 334, 611, 697
MmeI TCCRAC 1 cut(s) 740
MnlI CCTC 7 cut(s) 132, 277, 410, 412, 582, 615, 761
MseI TTAA 3 cut(s) 168, 288, 447
MslI CAYNNNNRTG 1 cut(s) 598
MspA1I CMGCKG 1 cut(s) 637
MspR9I CCNGG 1 cut(s) 740
MvaI CCWGG 1 cut(s) 740
MwoI GCNNNNNNNGC 1 cut(s) 461
NcoI CCATGG 1 cut(s) 677
NdeII GATC 1 cut(s) 350
NheI GCTAGC 1 cut(s) 553
NlaIII CATG 4 cut(s) 107, 491, 588, 681
NmuCI GTSAC 3 cut(s) 298, 591, 671
OliI CACNNNNGTG 1 cut(s) 598
PfeI GAWTC 1 cut(s) 320
Psp6I CCWGG 1 cut(s) 738
PspGI CCWGG 1 cut(s) 738
PspPI GGNCC 1 cut(s) 484
RsaI GTAC 1 cut(s) 710
RsaNI GTAC 1 cut(s) 709
RseI CAYNNNNRTG 1 cut(s) 598
SaqAI TTAA 3 cut(s) 168, 288, 447
Sau3AI GATC 1 cut(s) 350
Sau96I GGNCC 1 cut(s) 484
ScrFI CCNGG 1 cut(s) 740
SetI ASST 7 cut(s) 179, 262, 421, 466, 503, 593, 749
SinI GGWCC 1 cut(s) 484
SmiMI CAYNNNNRTG 1 cut(s) 598
SmlI CTYRAG 1 cut(s) 39
SmoI CTYRAG 1 cut(s) 39
Sse9I AATT 8 cut(s) 17, 34, 84, 208, 230, 334, 611, 697
SsiI CCGC 2 cut(s) 23, 637
SspI AATATT 1 cut(s) 530
SspMI CTAG 2 cut(s) 461, 554
StyD4I CCNGG 1 cut(s) 738
StyI CCWWGG 1 cut(s) 677
TaaI ACNGT 2 cut(s) 60, 708
TaqI TCGA 2 cut(s) 353, 404
TasI AATT 8 cut(s) 17, 34, 84, 208, 230, 334, 611, 697
TfiI GAWTC 1 cut(s) 320
Tru1I TTAA 3 cut(s) 168, 288, 447
Tru9I TTAA 3 cut(s) 168, 288, 447
TseFI GTSAC 3 cut(s) 298, 591, 671
Tsp45I GTSAC 3 cut(s) 298, 591, 671
TspDTI ATGAA 4 cut(s) 120, 507, 533, 792
TspGWI ACGGA 1 cut(s) 620
VpaK11BI GGWCC 1 cut(s) 484
XapI RAATTY 3 cut(s) 84, 208, 697
XmiI GTMKAC 1 cut(s) 152
XspI CTAG 2 cut(s) 461, 554
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.