Rmu_sc0014005.1_g000004

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014005.1
OG0001470
Physical Location & Seq
Reverse (-)
12459 .. 13370
912 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014005.1_g000004.1.cds

Sequence Viewer

Length: 912 bp
atgaatgagagattggattttcatctgcagggttggcaagggaagttcctctcaaaaccaggtaagcttgttcttattaaagctgtggctcaagcaatccccacttattcaatgagtgtgtttcagttgccaatcagtgtttgtaggaagttccaatctaaggtgagccaattttggtggagtaaaggtggtggtgctagaggtatccattggggtagttgggagaagttatgtaagaggaaggagaatgaaggtcctggtttcagggatttgcgggcatttaatcaagtaatgttagcaaaaactgcttggaggatattctggggtagaaggtctttggttagtgatatcttgcaagccaagtattttccgaccacatgttttttgaatgcttctttggggactactccttcgacagtttggagaggattgatgtggggtaaacaagtgcttgattgtggaaccaggtggcgtattggtaatggtttgcgggttagaatcagagaagatagatggttaccttgtcctattgggtttaatgttgtttctccggtaactttaccggcggagtggacagtggccaatctattcattgaatctggtgtgtggaatgttcctatgataaaatctatgttcctggctcatgaagcagatttgattctaagtatgccattggggttacgaacaattccagataagttggtttggcattatacgaagaatggaagttttagtgtgaaaacggggtattgggtggctcgtgatttgacagcaagtaagagtggaaatgtagctgactgtagttcctccggtgtgccagcaatctggaggaaagtatggggtttgaatgtaccacataaagttaaacttttaatttggagggccatcaataactttctcccatgtggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

303

Amino Acids

34.4

Weight (kDa)

10.25

Isoelectric Point (pI)

32.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 274, 490, 566
AcoI YGGCCR 1 cut(s) 579
AfaI GTAC 1 cut(s) 852
AfiI CCNNNNNNNGG 1 cut(s) 160
AflIII ACRYGT 1 cut(s) 377
AgsI TTSAA 4 cut(s) 111, 388, 596, 847
AjnI CCWGG 4 cut(s) 58, 256, 464, 636
AjuI GAANNNNNNNTTGG 3 cut(s) 28, 380, 412
AluBI AGCT 3 cut(s) 67, 83, 794
AluI AGCT 3 cut(s) 67, 83, 794
AoxI GGCC 2 cut(s) 579, 882
ArsI GACNNNNNNTTYG 2 cut(s) 394, 426
AspS9I GGNCC 2 cut(s) 254, 882
AsuHPI GGTGA 1 cut(s) 175
AvaII GGWCC 1 cut(s) 254
BalI TGGCCA 1 cut(s) 581
BauI CACGAG 1 cut(s) 759
BccI CCATC 2 cut(s) 507, 893
BciT130I CCWGG 4 cut(s) 60, 258, 466, 638
BciVI GTATCC 1 cut(s) 215
BfaI CTAG 1 cut(s) 198
BfmI CTRYAG 2 cut(s) 26, 799
BfuI GTATCC 1 cut(s) 215
Bme1390I CCNGG 4 cut(s) 60, 258, 466, 638
Bme18I GGWCC 1 cut(s) 254
BmgT120I GGNCC 2 cut(s) 254, 882
BmiI GGNNCC 1 cut(s) 463
BmrFI CCNGG 4 cut(s) 60, 258, 466, 638
BpmI CTGGAG 1 cut(s) 847
BpuEI CTTGAG 1 cut(s) 75
BsaBI GATNNNNATC 1 cut(s) 21
BsaWI WCCGGW 2 cut(s) 550, 809
BsaXI ACNNNNNCTCC 2 cut(s) 172, 202
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse118I RCCGGY 1 cut(s) 562
Bse8I GATNNNNATC 1 cut(s) 21
BseBI CCWGG 4 cut(s) 60, 258, 466, 638
BseJI GATNNNNATC 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 160
BshFI GGCC 2 cut(s) 581, 884
BsiSI CCGG 3 cut(s) 551, 563, 810
BslFI GGGAC 1 cut(s) 415
BslI CCNNNNNNNGG 1 cut(s) 160
BsmFI GGGAC 1 cut(s) 415
BsmI GAATGC 1 cut(s) 394
BsnI GGCC 2 cut(s) 581, 884
BspACI CCGC 3 cut(s) 274, 490, 566
BspANI GGCC 2 cut(s) 581, 884
BspHI TCATGA 1 cut(s) 643
BspLI GGNNCC 1 cut(s) 463
BspMAI CTGCAG 1 cut(s) 30
BsrFI RCCGGY 1 cut(s) 562
BssAI RCCGGY 1 cut(s) 562
BssSI CACGAG 1 cut(s) 759
Bst2BI CACGAG 1 cut(s) 759
Bst2UI CCWGG 4 cut(s) 60, 258, 466, 638
Bst4CI ACNGT 3 cut(s) 418, 577, 800
BstAPI GCANNNNNTGC 1 cut(s) 305
BstC8I GCNNGC 3 cut(s) 276, 357, 819
BstDEI CTNAG 2 cut(s) 159, 662
BstEII GGTNACC 1 cut(s) 516
BstMWI GCNNNNNNNGC 3 cut(s) 34, 305, 647
BstNI CCWGG 4 cut(s) 60, 258, 466, 638
BstNSI RCATGY 1 cut(s) 381
BstPI GGTNACC 1 cut(s) 516
BstSCI CCNGG 4 cut(s) 58, 256, 464, 636
BstSFI CTRYAG 2 cut(s) 26, 799
BstXI CCANNNNNNTGG 1 cut(s) 825
BsuI GTATCC 1 cut(s) 215
BsuRI GGCC 2 cut(s) 581, 884
BtsIMutI CAGTG 2 cut(s) 142, 582
Cac8I GCNNGC 3 cut(s) 276, 357, 819
CciI TCATGA 1 cut(s) 643
Cfr10I RCCGGY 1 cut(s) 562
Cfr13I GGNCC 2 cut(s) 254, 882
CsiI ACCWGGT 2 cut(s) 58, 464
Csp6I GTAC 1 cut(s) 851
CspCI CAANNNNNGTGG 2 cut(s) 158, 193
CviAII CATG 3 cut(s) 378, 644, 903
CviQI GTAC 1 cut(s) 851
DdeI CTNAG 2 cut(s) 159, 662
EaeI YGGCCR 1 cut(s) 579
EciI GGCGGA 1 cut(s) 581
Eco32I GATATC 1 cut(s) 349
Eco47I GGWCC 1 cut(s) 254
Eco91I GGTNACC 1 cut(s) 516
EcoO109I RGGNCCY 1 cut(s) 254
EcoO65I GGTNACC 1 cut(s) 516
EcoRII CCWGG 4 cut(s) 58, 256, 464, 636
EcoRV GATATC 1 cut(s) 349
FaeI CATG 3 cut(s) 381, 647, 906
FalI AAGNNNNNCTT 2 cut(s) 852, 884
FaqI GGGAC 1 cut(s) 415
FatI CATG 3 cut(s) 377, 643, 902
FauI CCCGC 2 cut(s) 267, 483
FspBI CTAG 1 cut(s) 198
GsuI CTGGAG 1 cut(s) 847
HaeIII GGCC 2 cut(s) 581, 884
HapII CCGG 3 cut(s) 551, 563, 810
Hin1II CATG 3 cut(s) 381, 647, 906
HindIII AAGCTT 1 cut(s) 65
HinfI GANTC 3 cut(s) 498, 596, 658
HpaII CCGG 3 cut(s) 551, 563, 810
HphI GGTGA 1 cut(s) 175
Hpy166II GTNNAC 2 cut(s) 443, 573
Hpy188I TCNGA 2 cut(s) 372, 503
Hpy188III TCNNGA 4 cut(s) 644, 692, 761, 826
Hpy8I GTNNAC 2 cut(s) 443, 573
HpyAV CCTTC 4 cut(s) 235, 245, 324, 420
HpyCH4III ACNGT 3 cut(s) 418, 577, 800
HpyCH4V TGCA 2 cut(s) 28, 355
HpyF10VI GCNNNNNNNGC 3 cut(s) 34, 305, 647
HpyF3I CTNAG 2 cut(s) 159, 662
Hsp92II CATG 3 cut(s) 381, 647, 906
MabI ACCWGGT 2 cut(s) 58, 464
MaeI CTAG 1 cut(s) 198
MaeIII GTNAC 3 cut(s) 516, 553, 678
MboII GAAGA 2 cut(s) 518, 730
MlsI TGGCCA 1 cut(s) 581
MluCI AATT 3 cut(s) 170, 687, 873
MluNI TGGCCA 1 cut(s) 581
MmeI TCCRAC 1 cut(s) 395
MnlI CCTC 8 cut(s) 59, 194, 231, 306, 419, 817, 822, 873
Mox20I TGGCCA 1 cut(s) 581
MscI TGGCCA 1 cut(s) 581
MseI TTAA 5 cut(s) 78, 282, 537, 864, 872
Msp20I TGGCCA 1 cut(s) 581
MspI CCGG 3 cut(s) 551, 563, 810
MspR9I CCNGG 4 cut(s) 60, 258, 466, 638
Mva1269I GAATGC 1 cut(s) 394
MvaI CCWGG 4 cut(s) 60, 258, 466, 638
MwoI GCNNNNNNNGC 3 cut(s) 34, 305, 647
NlaIII CATG 3 cut(s) 381, 647, 906
NlaIV GGNNCC 1 cut(s) 463
NspI RCATGY 1 cut(s) 381
PagI TCATGA 1 cut(s) 643
PciI ACATGT 1 cut(s) 377
PctI GAATGC 1 cut(s) 394
PfeI GAWTC 3 cut(s) 498, 596, 658
PpuMI RGGWCCY 1 cut(s) 254
PscI ACATGT 1 cut(s) 377
Psp5II RGGWCCY 1 cut(s) 254
Psp6I CCWGG 4 cut(s) 58, 256, 464, 636
PspEI GGTNACC 1 cut(s) 516
PspGI CCWGG 4 cut(s) 58, 256, 464, 636
PspN4I GGNNCC 1 cut(s) 463
PspPI GGNCC 2 cut(s) 254, 882
PspPPI RGGWCCY 1 cut(s) 254
PstI CTGCAG 1 cut(s) 30
RsaI GTAC 1 cut(s) 852
RsaNI GTAC 1 cut(s) 851
SaqAI TTAA 5 cut(s) 78, 282, 537, 864, 872
Sau96I GGNCC 2 cut(s) 254, 882
ScrFI CCNGG 4 cut(s) 60, 258, 466, 638
SexAI ACCWGGT 2 cut(s) 58, 464
SfcI CTRYAG 2 cut(s) 26, 799
SinI GGWCC 1 cut(s) 254
SmlI CTYRAG 1 cut(s) 90
SmoI CTYRAG 1 cut(s) 90
Sse9I AATT 3 cut(s) 170, 687, 873
SsiI CCGC 3 cut(s) 274, 490, 566
SspMI CTAG 1 cut(s) 198
StyD4I CCNGG 4 cut(s) 58, 256, 464, 636
TaaI ACNGT 3 cut(s) 418, 577, 800
TaqI TCGA 1 cut(s) 413
TasI AATT 3 cut(s) 170, 687, 873
TfiI GAWTC 3 cut(s) 498, 596, 658
Tru1I TTAA 5 cut(s) 78, 282, 537, 864, 872
Tru9I TTAA 5 cut(s) 78, 282, 537, 864, 872
TscAI CASTG 2 cut(s) 142, 582
TspDTI ATGAA 5 cut(s) 11, 17, 264, 580, 660
TspRI CASTG 2 cut(s) 142, 582
VpaK11BI GGWCC 1 cut(s) 254
XceI RCATGY 1 cut(s) 381
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.