Rmu_sc0003052.1_g000009

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003052.1
Physical Location & Seq
Reverse (-)
32769 .. 33335
567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003052.1_g000009.1.cds

Sequence Viewer

Length: 567 bp
atgatcattttcccttatatttttgagtttatatctaattttataaaaaagaaatctatactaagtgaccagaaattacaggggtggcagttcaaactcttatctaaggcaaggaaaacggtgttgatcaaggccgttgtgcaagccatcccgtcctacactacgtcggtgttcagattgtccaagggtatttgccgaacctatcagtctaaggttggtaagtactggtggggtaatggtggtaagaagaaaggaatatactggtgcaagtgggaggtcctatccaagaataaattagcaggaggcttaggtttcagggacattgagtgctttaatcaggccctactagcgaagactttgtggcggattatgctccatcatgattttttggttaatcatatcttacagttgaagtatggcattggaggtaattgggcagcagctcaagtgggaagaaagtcatcatttatttggaggagtcttgtgtggcgaaatgaattgttgtgtgcaggaattcgttggagagttgggaatggtgaaactacaagagtctgggaggataagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

188

Amino Acids

21.86

Weight (kDa)

10.23

Isoelectric Point (pI)

20.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 44
AciI CCGC 1 cut(s) 364
AcsI RAATTY 1 cut(s) 513
AfaI GTAC 1 cut(s) 224
AgsI TTSAA 2 cut(s) 94, 412
AluBI AGCT 1 cut(s) 443
AluI AGCT 1 cut(s) 443
AoxI GGCC 2 cut(s) 132, 339
ApeKI GCWGC 2 cut(s) 437, 440
ApoI RAATTY 1 cut(s) 513
AspS9I GGNCC 2 cut(s) 277, 340
AsuHPI GGTGA 1 cut(s) 548
AvaII GGWCC 1 cut(s) 277
BbsI GAAGAC 1 cut(s) 359
BbvI GCAGC 2 cut(s) 449, 452
BccI CCATC 2 cut(s) 155, 384
BceAI ACGGC 1 cut(s) 119
BclI TGATCA 2 cut(s) 3, 126
BfaI CTAG 1 cut(s) 347
BisI GCNGC 2 cut(s) 438, 441
BlsI GCNGC 2 cut(s) 439, 442
BmcAI AGTACT 1 cut(s) 224
Bme18I GGWCC 1 cut(s) 277
BmgT120I GGNCC 2 cut(s) 277, 340
BpiI GAAGAC 1 cut(s) 359
Bpu10I CCTNAGC 1 cut(s) 307
BpuEI CTTGAG 1 cut(s) 429
BsaJI CCNNGG 1 cut(s) 183
BsaXI ACNNNNNCTCC 1 cut(s) 548
Bse1I ACTGG 2 cut(s) 230, 266
BseDI CCNNGG 1 cut(s) 183
BseGI GGATG 1 cut(s) 147
BseNI ACTGG 2 cut(s) 230, 266
BseRI GAGGAG 1 cut(s) 490
BseXI GCAGC 2 cut(s) 449, 452
BsgI GTGCAG 1 cut(s) 528
BshFI GGCC 2 cut(s) 134, 341
BslFI GGGAC 1 cut(s) 332
BsmFI GGGAC 1 cut(s) 332
BsnI GGCC 2 cut(s) 134, 341
Bsp143I GATC 2 cut(s) 3, 126
BspACI CCGC 1 cut(s) 364
BspANI GGCC 2 cut(s) 134, 341
BspHI TCATGA 1 cut(s) 379
BsrI ACTGG 2 cut(s) 230, 266
BssECI CCNNGG 1 cut(s) 183
BssMI GATC 2 cut(s) 3, 126
BssT1I CCWWGG 1 cut(s) 183
Bst4CI ACNGT 2 cut(s) 121, 408
BstC8I GCNNGC 1 cut(s) 144
BstDEI CTNAG 4 cut(s) 62, 105, 210, 307
BstF5I GGATG 1 cut(s) 147
BstKTI GATC 2 cut(s) 6, 129
BstMBI GATC 2 cut(s) 3, 126
BstMWI GCNNNNNNNGC 2 cut(s) 347, 370
BstV1I GCAGC 2 cut(s) 449, 452
BstV2I GAAGAC 1 cut(s) 359
BsuRI GGCC 2 cut(s) 134, 341
BtsCI GGATG 1 cut(s) 147
Cac8I GCNNGC 1 cut(s) 144
CciI TCATGA 1 cut(s) 379
Cfr13I GGNCC 2 cut(s) 277, 340
Csp6I GTAC 1 cut(s) 223
CviAII CATG 1 cut(s) 380
CviJI RGCY 5 cut(s) 134, 146, 306, 341, 443
CviKI_1 RGCY 5 cut(s) 134, 146, 306, 341, 443
CviQI GTAC 1 cut(s) 223
DdeI CTNAG 4 cut(s) 62, 105, 210, 307
DpnI GATC 2 cut(s) 5, 128
DpnII GATC 2 cut(s) 3, 126
EciI GGCGGA 1 cut(s) 379
Eco130I CCWWGG 1 cut(s) 183
Eco47I GGWCC 1 cut(s) 277
EcoO109I RGGNCCY 2 cut(s) 277, 340
EcoRI GAATTC 1 cut(s) 513
EcoT14I CCWWGG 1 cut(s) 183
ErhI CCWWGG 1 cut(s) 183
FaeI CATG 1 cut(s) 383
FaiI YATR 9 cut(s) 18, 32, 44, 59, 259, 371, 381, 399, 417
FaqI GGGAC 1 cut(s) 332
FatI CATG 1 cut(s) 379
FbaI TGATCA 2 cut(s) 3, 126
Fnu4HI GCNGC 2 cut(s) 438, 441
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 2 cut(s) 438, 441
FspBI CTAG 1 cut(s) 347
GluI GCNGC 2 cut(s) 438, 441
HaeIII GGCC 2 cut(s) 134, 341
Hin1II CATG 1 cut(s) 383
HinfI GANTC 2 cut(s) 478, 549
HphI GGTGA 1 cut(s) 548
Hpy188I TCNGA 1 cut(s) 176
Hpy188III TCNNGA 1 cut(s) 380
Hpy99I CGWCG 1 cut(s) 169
HpyCH4III ACNGT 2 cut(s) 121, 408
HpyCH4IV ACGT 1 cut(s) 164
HpyCH4V TGCA 3 cut(s) 142, 267, 509
HpyF10VI GCNNNNNNNGC 2 cut(s) 347, 370
HpyF3I CTNAG 4 cut(s) 62, 105, 210, 307
HpySE526I ACGT 1 cut(s) 164
Hsp92II CATG 1 cut(s) 383
Ksp22I TGATCA 2 cut(s) 3, 126
Kzo9I GATC 2 cut(s) 3, 126
LmnI GCTCC 1 cut(s) 378
LpnPI CCDG 9 cut(s) 65, 83, 211, 247, 285, 301, 323, 495, 538
Lsp1109I GCAGC 2 cut(s) 449, 452
MaeI CTAG 1 cut(s) 347
MaeII ACGT 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 65
MalI GATC 2 cut(s) 5, 128
MboI GATC 2 cut(s) 3, 126
MboII GAAGA 3 cut(s) 259, 364, 465
MluCI AATT 6 cut(s) 37, 74, 293, 430, 497, 513
MlyI GAGTC 2 cut(s) 487, 558
MmeI TCCRAC 1 cut(s) 500
MnlI CCTC 5 cut(s) 268, 296, 419, 468, 550
MseI TTAA 2 cut(s) 333, 393
MwoI GCNNNNNNNGC 2 cut(s) 347, 370
NdeII GATC 2 cut(s) 3, 126
NlaIII CATG 1 cut(s) 383
NmuCI GTSAC 1 cut(s) 65
PagI TCATGA 1 cut(s) 379
PkrI GCNGC 2 cut(s) 439, 442
PleI GAGTC 2 cut(s) 486, 557
PpsI GAGTC 2 cut(s) 486, 557
PpuMI RGGWCCY 1 cut(s) 277
PsiI TTATAA 1 cut(s) 44
Psp5II RGGWCCY 1 cut(s) 277
PspPI GGNCC 2 cut(s) 277, 340
PspPPI RGGWCCY 1 cut(s) 277
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
SaqAI TTAA 2 cut(s) 333, 393
SatI GCNGC 2 cut(s) 438, 441
Sau3AI GATC 2 cut(s) 3, 126
Sau96I GGNCC 2 cut(s) 277, 340
ScaI AGTACT 1 cut(s) 224
SchI GAGTC 2 cut(s) 487, 558
SetI ASST 7 cut(s) 167, 203, 216, 279, 313, 430, 445
SinI GGWCC 1 cut(s) 277
SmlI CTYRAG 1 cut(s) 444
SmoI CTYRAG 1 cut(s) 444
Sse9I AATT 6 cut(s) 37, 74, 293, 430, 497, 513
SsiI CCGC 1 cut(s) 364
SspMI CTAG 1 cut(s) 347
StyI CCWWGG 1 cut(s) 183
TaaI ACNGT 2 cut(s) 121, 408
TaiI ACGT 1 cut(s) 167
TasI AATT 6 cut(s) 37, 74, 293, 430, 497, 513
TatI WGTACW 1 cut(s) 222
Tru1I TTAA 2 cut(s) 333, 393
Tru9I TTAA 2 cut(s) 333, 393
TseFI GTSAC 1 cut(s) 65
TseI GCWGC 2 cut(s) 437, 440
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 510
VpaK11BI GGWCC 1 cut(s) 277
XapI RAATTY 1 cut(s) 513
XspI CTAG 1 cut(s) 347
ZrmI AGTACT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.