RchiOBHm_Chr5g0012551

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
8453015 .. 8453382
368 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGTTCCCAATTGAAGCCAAGGTAAGCTGGTTGATGTCTTTGGATGGGAATTGGAATCTGGAACTGCTTTGTAACTGTTTTACTGAGAATGAGGTTGCTTTAATTCTTTCTATCCCCATTCCCAACTATCATATCAAAGATAAGTTGATTTGGCATTTCTCTCGTAATGGTGTTTATACTGTTAAGAGTGGATATTGGGCGACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.93

Weight (kDa)

6.01

Isoelectric Point (pI)

30.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 14
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
BccI CCATC 1 cut(s) 38
BcgI CGANNNNNNTGC 2 cut(s) 143, 177
BsaJI CCNNGG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 49
BseMII CTCAG 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 18
BssT1I CCWWGG 1 cut(s) 18
Bst4CI ACNGT 2 cut(s) 77, 181
BstDEI CTNAG 1 cut(s) 84
BstF5I GGATG 1 cut(s) 49
BtsCI GGATG 1 cut(s) 49
CviJI RGCY 2 cut(s) 17, 27
CviKI_1 RGCY 2 cut(s) 17, 27
DdeI CTNAG 1 cut(s) 84
Eco130I CCWWGG 1 cut(s) 18
EcoT14I CCWWGG 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 18
FaiI YATR 3 cut(s) 132, 177, 205
FokI GGATG 1 cut(s) 56
HinfI GANTC 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 59
HpyCH4III ACNGT 2 cut(s) 77, 181
HpyF3I CTNAG 1 cut(s) 84
LpnPI CCDG 2 cut(s) 13, 44
MaeIII GTNAC 1 cut(s) 71
MfeI CAATTG 1 cut(s) 9
MluCI AATT 3 cut(s) 9, 49, 102
MnlI CCTC 1 cut(s) 85
MseI TTAA 2 cut(s) 101, 183
MunI CAATTG 1 cut(s) 9
PfeI GAWTC 1 cut(s) 55
SaqAI TTAA 2 cut(s) 101, 183
SetI ASST 3 cut(s) 24, 29, 96
SgeI CNNG 4 cut(s) 31, 40, 71, 174
Sse9I AATT 3 cut(s) 9, 49, 102
StyI CCWWGG 1 cut(s) 18
TaaI ACNGT 2 cut(s) 77, 181
TasI AATT 3 cut(s) 9, 49, 102
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 2 cut(s) 101, 183
Tru9I TTAA 2 cut(s) 101, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.