RchiOBHm_Chr2g0138811

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0000927
Physical Location & Seq
Forward (+)
56465772 .. 56468815
3044 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50943

Sequence Viewer

Length: 174 bp
ATGTGGCCTCCTAGTCCCCGACGCATGCGTAAGCCATTCTCAAAATTCAAAGCTACTCTGCTAGTCTTTTTGGGGCGTGAAATTGAAGATTCCAATGTGTTTCGCTTGAAATTTAGAGCTCCAGGGAGAAGCCTTTTCTGTATGAAATTGTGGCAAATGGGCGTAATGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.82

Weight (kDa)

11.64

Isoelectric Point (pI)

66.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 44, 110
AgsI TTSAA 3 cut(s) 49, 86, 109
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 2 cut(s) 53, 119
AluI AGCT 2 cut(s) 53, 119
Alw21I GWGCWC 1 cut(s) 121
AoxI GGCC 1 cut(s) 5
ApoI RAATTY 2 cut(s) 44, 110
BanII GRGCYC 1 cut(s) 121
Bbv12I GWGCWC 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 123
BfaI CTAG 2 cut(s) 12, 62
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BpmI CTGGAG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 122
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 122
BshFI GGCC 1 cut(s) 7
BsiHKAI GWGCWC 1 cut(s) 121
BsnI GGCC 1 cut(s) 7
Bsp1286I GDGCHC 1 cut(s) 121
BspANI GGCC 1 cut(s) 7
BssECI CCNNGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 26
BstNI CCWGG 1 cut(s) 123
BstNSI RCATGY 1 cut(s) 28
BstSCI CCNGG 1 cut(s) 121
BsuRI GGCC 1 cut(s) 7
Cac8I GCNNGC 1 cut(s) 26
CseI GACGC 1 cut(s) 30
CviAII CATG 1 cut(s) 25
CviJI RGCY 5 cut(s) 7, 34, 53, 119, 132
CviKI_1 RGCY 5 cut(s) 7, 34, 53, 119, 132
Ecl136II GAGCTC 1 cut(s) 119
Eco24I GRGCYC 1 cut(s) 121
Eco53kI GAGCTC 1 cut(s) 119
EcoICRI GAGCTC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 121
EcoT38I GRGCYC 1 cut(s) 121
FaeI CATG 1 cut(s) 28
FaiI YATR 2 cut(s) 26, 143
FatI CATG 1 cut(s) 24
FriOI GRGCYC 1 cut(s) 121
FspBI CTAG 2 cut(s) 12, 62
GsuI CTGGAG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 7
HgaI GACGC 1 cut(s) 30
Hin1II CATG 1 cut(s) 28
HinfI GANTC 1 cut(s) 89
Hpy99I CGWCG 1 cut(s) 24
Hsp92II CATG 1 cut(s) 28
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 2 cut(s) 108, 135
MaeI CTAG 2 cut(s) 12, 62
MboII GAAGA 1 cut(s) 98
MhlI GDGCHC 1 cut(s) 121
MluCI AATT 4 cut(s) 44, 81, 110, 146
MnlI CCTC 1 cut(s) 18
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
NlaIII CATG 1 cut(s) 28
NspI RCATGY 1 cut(s) 28
PaeI GCATGC 1 cut(s) 28
PfeI GAWTC 1 cut(s) 89
Psp124BI GAGCTC 1 cut(s) 121
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
SacI GAGCTC 1 cut(s) 121
ScrFI CCNGG 1 cut(s) 123
SduI GDGCHC 1 cut(s) 121
SetI ASST 2 cut(s) 55, 121
SgeI CNNG 8 cut(s) 24, 30, 37, 74, 89, 118, 134, 135
SphI GCATGC 1 cut(s) 28
Sse9I AATT 4 cut(s) 44, 81, 110, 146
SspMI CTAG 2 cut(s) 12, 62
SstI GAGCTC 1 cut(s) 121
StyD4I CCNGG 1 cut(s) 121
TasI AATT 4 cut(s) 44, 81, 110, 146
TfiI GAWTC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 158
XapI RAATTY 2 cut(s) 44, 110
XceI RCATGY 1 cut(s) 28
XspI CTAG 2 cut(s) 12, 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.