Rroxscaffold_3G00241970

histone-lysine N-methyltransferase, H3 lysine-9 specific

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
34309547 .. 34309939
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00241970.1

Sequence Viewer

Length: 159 bp
ATGAACACGAATAAAAGTTGGGTTCTTAAAGTTTTCAATTTCATGGTTGGTGTGCGAGGACATAACTGGGGTCTAGAGGATATTGCCATTCCAGCTAGCAATTTGGTCGATGATCCGCCTGTTGCTCCTACGGGCAAGTTGATCATGTTCATGGAGTAA

Protein Analysis

52

Amino Acids

5.8

Weight (kDa)

5.6

Isoelectric Point (pI)

9.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AclWI GGATC 1 cut(s) 107
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AlwI GGATC 1 cut(s) 107
AsuNHI GCTAGC 1 cut(s) 95
BcgI CGANNNNNNTGC 2 cut(s) 88, 122
BclI TGATCA 1 cut(s) 141
BfaI CTAG 2 cut(s) 74, 96
BmrI ACTGGG 1 cut(s) 76
BmtI GCTAGC 1 cut(s) 99
BmuI ACTGGG 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 71
Bsp143I GATC 2 cut(s) 112, 141
BspACI CCGC 1 cut(s) 116
BspOI GCTAGC 1 cut(s) 99
BspPI GGATC 1 cut(s) 107
BsrI ACTGG 1 cut(s) 71
BssMI GATC 2 cut(s) 112, 141
BstC8I GCNNGC 1 cut(s) 97
BstKTI GATC 2 cut(s) 115, 144
BstMBI GATC 2 cut(s) 112, 141
BstMWI GCNNNNNNNGC 1 cut(s) 92
Cac8I GCNNGC 1 cut(s) 97
CviAII CATG 3 cut(s) 43, 145, 151
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DpnI GATC 2 cut(s) 114, 143
DpnII GATC 2 cut(s) 112, 141
EciI GGCGGA 1 cut(s) 105
FaeI CATG 3 cut(s) 46, 148, 154
FaiI YATR 4 cut(s) 44, 63, 146, 152
FatI CATG 3 cut(s) 42, 144, 150
FbaI TGATCA 1 cut(s) 141
FspBI CTAG 2 cut(s) 74, 96
Hin1II CATG 3 cut(s) 46, 148, 154
Hpy188III TCNNGA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
Hsp92II CATG 3 cut(s) 46, 148, 154
Ksp22I TGATCA 1 cut(s) 141
Kzo9I GATC 2 cut(s) 112, 141
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 52, 105, 132
MaeI CTAG 2 cut(s) 74, 96
MalI GATC 2 cut(s) 114, 143
MboI GATC 2 cut(s) 112, 141
MluCI AATT 2 cut(s) 37, 100
MnlI CCTC 2 cut(s) 50, 70
MseI TTAA 1 cut(s) 27
MslI CAYNNNNRTG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 2 cut(s) 112, 141
NheI GCTAGC 1 cut(s) 95
NlaIII CATG 3 cut(s) 46, 148, 154
RseI CAYNNNNRTG 1 cut(s) 149
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 2 cut(s) 112, 141
SetI ASST 1 cut(s) 97
SmiMI CAYNNNNRTG 1 cut(s) 149
Sse9I AATT 2 cut(s) 37, 100
SsiI CCGC 1 cut(s) 116
SspMI CTAG 2 cut(s) 74, 96
TaqI TCGA 1 cut(s) 108
TasI AATT 2 cut(s) 37, 100
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TspDTI ATGAA 3 cut(s) 17, 31, 139
XbaI TCTAGA 1 cut(s) 73
XspI CTAG 2 cut(s) 74, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.