Rh3DG293500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0000927
Physical Location & Seq
Reverse (-)
30459138 .. 30469470
10333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG293500.1

Sequence Viewer

Length: 216 bp
ATGAGAATCCAATTCCCCAAACACCAAAACCCCAATTTGAATTGGGCATTGAGGATCCAAACCTCAGTTTCAATTCGACAAGATATCTGGGAAGTATTCCTCGGCCTGAAGACATCGGATCTGAAGCGCGGGAGGGAATGCATTTGGAATGTGTACAAAAAGCAATCCACCTTGGGCATGGCGAAAAACAAATATCAATGGTGGACGACAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.6

Weight (kDa)

10.29

Isoelectric Point (pI)

32.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 129
AciI CCGC 1 cut(s) 129
AclWI GGATC 3 cut(s) 49, 62, 126
AcuI CTGAAG 2 cut(s) 128, 143
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 2 cut(s) 40, 72
AlwI GGATC 3 cut(s) 49, 62, 126
AoxI GGCC 1 cut(s) 103
AspLEI GCGC 1 cut(s) 129
BamHI GGATCC 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 116
BmiI GGNNCC 1 cut(s) 56
BpiI GAAGAC 1 cut(s) 116
BsaJI CCNNGG 2 cut(s) 100, 171
BseDI CCNNGG 2 cut(s) 100, 171
BseMII CTCAG 1 cut(s) 78
Bsh1236I CGCG 1 cut(s) 129
BshFI GGCC 1 cut(s) 105
BsmI GAATGC 1 cut(s) 143
BsnI GGCC 1 cut(s) 105
Bsp1407I TGTACA 1 cut(s) 153
Bsp143I GATC 2 cut(s) 54, 118
BspACI CCGC 1 cut(s) 129
BspANI GGCC 1 cut(s) 105
BspCNI CTCAG 1 cut(s) 77
BspFNI CGCG 1 cut(s) 129
BspLI GGNNCC 1 cut(s) 56
BspPI GGATC 3 cut(s) 49, 62, 126
BsrGI TGTACA 1 cut(s) 153
BssECI CCNNGG 2 cut(s) 100, 171
BssMI GATC 2 cut(s) 54, 118
BssT1I CCWWGG 1 cut(s) 171
BstAUI TGTACA 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 64
BstFNI CGCG 1 cut(s) 129
BstHHI GCGC 1 cut(s) 129
BstKTI GATC 2 cut(s) 57, 121
BstMBI GATC 2 cut(s) 54, 118
BstUI CGCG 1 cut(s) 129
BstV2I GAAGAC 1 cut(s) 116
BstX2I RGATCY 2 cut(s) 54, 118
BstYI RGATCY 2 cut(s) 54, 118
BsuRI GGCC 1 cut(s) 105
CfoI GCGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 154
CviAII CATG 1 cut(s) 178
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 1 cut(s) 64
DpnI GATC 2 cut(s) 56, 120
DpnII GATC 2 cut(s) 54, 118
Eco130I CCWWGG 1 cut(s) 171
Eco32I GATATC 1 cut(s) 85
Eco57I CTGAAG 2 cut(s) 128, 143
EcoRV GATATC 1 cut(s) 85
EcoT14I CCWWGG 1 cut(s) 171
EcoT22I ATGCAT 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 171
FaeI CATG 1 cut(s) 181
FaiI YATR 1 cut(s) 179
FatI CATG 1 cut(s) 177
FauI CCCGC 1 cut(s) 122
GlaI GCGC 1 cut(s) 128
HaeIII GGCC 1 cut(s) 105
HhaI GCGC 1 cut(s) 129
Hin1II CATG 1 cut(s) 181
Hin6I GCGC 1 cut(s) 127
HinP1I GCGC 1 cut(s) 127
HinfI GANTC 1 cut(s) 6
Hpy166II GTNNAC 2 cut(s) 154, 204
Hpy188I TCNGA 2 cut(s) 118, 123
Hpy8I GTNNAC 2 cut(s) 154, 204
HpyCH4V TGCA 1 cut(s) 141
HpyF3I CTNAG 1 cut(s) 64
Hsp92II CATG 1 cut(s) 181
HspAI GCGC 1 cut(s) 127
Kzo9I GATC 2 cut(s) 54, 118
LpnPI CCDG 2 cut(s) 73, 119
MalI GATC 2 cut(s) 56, 120
MboI GATC 2 cut(s) 54, 118
MboII GAAGA 1 cut(s) 121
MflI RGATCY 2 cut(s) 54, 118
MluCI AATT 4 cut(s) 11, 34, 40, 72
MnlI CCTC 4 cut(s) 45, 73, 110, 126
Mph1103I ATGCAT 1 cut(s) 143
Mva1269I GAATGC 1 cut(s) 143
MvnI CGCG 1 cut(s) 129
NdeII GATC 2 cut(s) 54, 118
NlaIII CATG 1 cut(s) 181
NlaIV GGNNCC 1 cut(s) 56
NmeAIII GCCGAG 1 cut(s) 81
NsiI ATGCAT 1 cut(s) 143
PctI GAATGC 1 cut(s) 143
PfeI GAWTC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 56
PsuI RGATCY 2 cut(s) 54, 118
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
Sau3AI GATC 2 cut(s) 54, 118
SetI ASST 2 cut(s) 65, 173
SgeI CNNG 8 cut(s) 92, 100, 113, 118, 140, 142, 184, 190
Sse9I AATT 4 cut(s) 11, 34, 40, 72
SsiI CCGC 1 cut(s) 129
StyI CCWWGG 1 cut(s) 171
TaqI TCGA 1 cut(s) 76
TasI AATT 4 cut(s) 11, 34, 40, 72
TatI WGTACW 1 cut(s) 153
TfiI GAWTC 1 cut(s) 6
XcmI CCANNNNNNNNNTGG 1 cut(s) 175
Zsp2I ATGCAT 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.