RchiOBHm_Chr3g0476471

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0001200
Physical Location & Seq
Reverse (-)
22411884 .. 22413233
1350 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44189

Sequence Viewer

Length: 192 bp
ATGGGTCTAGACTTTGTTTATAGCATGATTTTGATGTTTTGGCAGGGATTTGGGTATTTGTTTCTGGTGGCTGCAGAATATTTGGTTCAGGGCGATGGGCTACGGACATCTTTTTGTAGAAGTACTTCTTTTTGCCGGTCATTGTTTTTCTATTCTCCAAGAAAAGTTACAAGCCCCCTAAGAAGCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.31

Weight (kDa)

9.24

Isoelectric Point (pI)

51.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 124
ApeKI GCWGC 1 cut(s) 71
Asp700I GAANNNNTTC 1 cut(s) 124
BarI GAAGNNNNNNTAC 2 cut(s) 109, 141
BbvI GCAGC 1 cut(s) 58
BccI CCATC 1 cut(s) 89
BfaI CTAG 1 cut(s) 8
BfmI CTRYAG 1 cut(s) 72
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
BmcAI AGTACT 1 cut(s) 124
Bse118I RCCGGY 1 cut(s) 135
BseXI GCAGC 1 cut(s) 58
BsiSI CCGG 1 cut(s) 136
BspMAI CTGCAG 1 cut(s) 76
BsrFI RCCGGY 1 cut(s) 135
BssAI RCCGGY 1 cut(s) 135
BstDEI CTNAG 1 cut(s) 179
BstSFI CTRYAG 1 cut(s) 72
BstV1I GCAGC 1 cut(s) 58
BtgZI GCGATG 1 cut(s) 108
Cfr10I RCCGGY 1 cut(s) 135
Csp6I GTAC 1 cut(s) 123
CviAII CATG 1 cut(s) 25
CviJI RGCY 4 cut(s) 71, 100, 174, 186
CviKI_1 RGCY 4 cut(s) 71, 100, 174, 186
CviQI GTAC 1 cut(s) 123
DdeI CTNAG 1 cut(s) 179
FaeI CATG 1 cut(s) 28
FaiI YATR 2 cut(s) 21, 26
FalI AAGNNNNNCTT 2 cut(s) 112, 144
FatI CATG 1 cut(s) 24
Fnu4HI GCNGC 1 cut(s) 72
Fsp4HI GCNGC 1 cut(s) 72
FspBI CTAG 1 cut(s) 8
GluI GCNGC 1 cut(s) 72
HapII CCGG 1 cut(s) 136
Hin1II CATG 1 cut(s) 28
HpaII CCGG 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 8
HpyCH4V TGCA 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 179
Hsp92II CATG 1 cut(s) 28
LpnPI CCDG 4 cut(s) 29, 50, 74, 149
Lsp1109I GCAGC 1 cut(s) 58
MaeI CTAG 1 cut(s) 8
MaeIII GTNAC 1 cut(s) 166
MroXI GAANNNNTTC 1 cut(s) 124
MseI TTAA 1 cut(s) 190
MspI CCGG 1 cut(s) 136
NlaIII CATG 1 cut(s) 28
PdmI GAANNNNTTC 1 cut(s) 124
PkrI GCNGC 1 cut(s) 73
PstI CTGCAG 1 cut(s) 76
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
SaqAI TTAA 1 cut(s) 190
SatI GCNGC 1 cut(s) 72
ScaI AGTACT 1 cut(s) 124
SfcI CTRYAG 1 cut(s) 72
SgeI CNNG 8 cut(s) 20, 37, 56, 77, 101, 148, 171, 183
SspI AATATT 1 cut(s) 80
SspMI CTAG 1 cut(s) 8
TatI WGTACW 1 cut(s) 122
Tru1I TTAA 1 cut(s) 190
Tru9I TTAA 1 cut(s) 190
TseI GCWGC 1 cut(s) 71
TspGWI ACGGA 1 cut(s) 118
XbaI TCTAGA 1 cut(s) 7
XmnI GAANNNNTTC 1 cut(s) 124
XspI CTAG 1 cut(s) 8
ZrmI AGTACT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.