Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001528.1

Orthogroup ID

OG0001200

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1170

Gene Structure 1170 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001528.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 395 bp

gaatgccttggcctggcgatgagggtgaacaacgatgggaacaagcatggttggctataaaaaaggtctgggcttcaaagtggaatgagagagcatacttcagcacaagaaaagtgaaattagaccatgattatctttgcatggctgtccttgttcaagaaataataaatgccgactatgcattcgttattcacacaaccaacctttcaggagactcgtcggagatatatgccgaggttgtcaaaggtcttggagaaaccttagttggagcttatcctggacgtgccttaagttttattagcaagaaaaatgctctggactctcctcaggtaatgcactacagtgccaaaagtggcataagagtaacataccatgtagggattgaattgcattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000272 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005975 GO:0005976 GO:0005982 GO:0005983 GO:0006073 GO:0006793 GO:0006796 GO:0006950 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009251 GO:0009266 GO:0009409 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009605 GO:0009607 GO:0009608 GO:0009610 GO:0009620 GO:0009628 GO:0009631 GO:0009941 GO:0009987 GO:0016052 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016781 GO:0031967 GO:0031975 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044042 GO:0044237 GO:0044238 GO:0044247 GO:0044248 GO:0044260 GO:0044262 GO:0044264 GO:0044275 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0050521 GO:0050896 GO:0051704 GO:0051707 GO:0071704 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPDK_N

Protein Analysis

130

Amino Acids

14.73

Weight (kDa)

6.5

Isoelectric Point (pI)

45.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001200)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0129611 RchiOBHm_Chr3g0476471 RchiOBHm_Chr6g0270131 RchiOBHm_Chr7g0233921 RchiOBHm_Chr7g0233931 RchiOBHm_Chr7g0234461 RchiOBHm_Chr7g0234611 RchiOBHm_Chr7g0234621
rosa_laevigata	RLG00000001213 RLG00000001221 RLG00000001227 RLG00000021012 RLG00000023959
rosa_multiflora	Rmu_co8468527.1_g000001 Rmu_sc0000974.1_g000014 Rmu_sc0001528.1_g000001 Rmu_sc0003291.1_g000028 Rmu_sc0003321.1_g000002 Rmu_sc0004303.1_g000006 Rmu_sc0004864.1_g000021 Rmu_sc0008667.1_g000013 Rmu_sc0011456.1_g000004 Rmu_sc0023836.1_g000001
rosa_roxburghii	Rroxscaffold_1G00049680 Rroxscaffold_3G00226730 Rroxscaffold_3G00226790 Rroxscaffold_3G00226800 Rroxscaffold_4G00302360
rosa_rugosa	Rorug01G0119600 Rorug01G0119700 Rorug01G0119800 Rorug02G0400100 Rorug07G0163100 Rorug07G0163100 Rorug07G0163200.1 Rorug07G0284900 Rorug07G0285500 RorugPtG0000400.1 RorugPtG0000500 RorugPtG0000600
rosa_samantha	Rh1DG123700 Rh2AG327500 Rh2DG356100 Rh2DG519500 Rh3DG370800 Rh5AG164500 Rh5CG516500 Rh7AG439900 Rh7BG412700 Rh7BG412900 Rh7BG413000 Rh7CG461700
rosa_wichuraiana	Rw2G026740 Rw7G036220 Rw7G036280 Rw7G036420 Rw7G036560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	84
AfiI	CCNNNNNNNGG	1 cut(s)	13
AflII	CTTAAG	1 cut(s)	288
AgsI	TTSAA	3 cut(s)	77, 157, 385
AjiI	CACGTC	1 cut(s)	283
AjnI	CCWGG	2 cut(s)	12, 276
AjuI	GAANNNNNNNTTGG	2 cut(s)	248, 280
AleI	CACNNNNGTG	1 cut(s)	341
AluBI	AGCT	1 cut(s)	271
AluI	AGCT	1 cut(s)	271
Alw26I	GTCTC	1 cut(s)	206
AoxI	GGCC	1 cut(s)	10
ArsI	GACNNNNNNTTYG	2 cut(s)	166, 198
AsuHPI	GGTGA	1 cut(s)	37
AxyI	CCTNAGG	1 cut(s)	326
BccI	CCATC	1 cut(s)	29
BciT130I	CCWGG	2 cut(s)	14, 278
BcoDI	GTCTC	1 cut(s)	206
BfmI	CTRYAG	1 cut(s)	339
BfrI	CTTAAG	1 cut(s)	288
Bme1390I	CCNGG	2 cut(s)	14, 278
BmgBI	CACGTC	1 cut(s)	283
BmrFI	CCNGG	2 cut(s)	14, 278
BsaJI	CCNNGG	2 cut(s)	7, 233
Bsc4I	CCNNNNNNNGG	1 cut(s)	13
Bse21I	CCTNAGG	1 cut(s)	326
BseBI	CCWGG	2 cut(s)	14, 278
BseDI	CCNNGG	2 cut(s)	7, 233
BseLI	CCNNNNNNNGG	1 cut(s)	13
BseMII	CTCAG	1 cut(s)	340
BseRI	GAGGAG	1 cut(s)	314
BshFI	GGCC	1 cut(s)	12
BslI	CCNNNNNNNGG	1 cut(s)	13
BsmAI	GTCTC	1 cut(s)	206
BsmI	GAATGC	2 cut(s)	8, 181
BsnI	GGCC	1 cut(s)	12
BspANI	GGCC	1 cut(s)	12
BspCNI	CTCAG	1 cut(s)	339
BspTI	CTTAAG	1 cut(s)	288
BssECI	CCNNGG	2 cut(s)	7, 233
BssT1I	CCWWGG	1 cut(s)	7
Bst2UI	CCWGG	2 cut(s)	14, 278
Bst4CI	ACNGT	1 cut(s)	343
BstAFI	CTTAAG	1 cut(s)	288
BstDEI	CTNAG	2 cut(s)	261, 326
BstMAI	GTCTC	1 cut(s)	206
BstMWI	GCNNNNNNNGC	2 cut(s)	52, 178
BstNI	CCWGG	2 cut(s)	14, 278
BstSCI	CCNGG	2 cut(s)	12, 276
BstSFI	CTRYAG	1 cut(s)	339
Bsu36I	CCTNAGG	1 cut(s)	326
BsuRI	GGCC	1 cut(s)	12
BtgZI	GCGATG	1 cut(s)	32
BtrI	CACGTC	1 cut(s)	283
BtsIMutI	CAGTG	1 cut(s)	348
CviAII	CATG	4 cut(s)	47, 127, 141, 373
CviJI	RGCY	5 cut(s)	12, 55, 73, 145, 271
CviKI_1	RGCY	5 cut(s)	12, 55, 73, 145, 271
DdeI	CTNAG	2 cut(s)	261, 326
Eco130I	CCWWGG	1 cut(s)	7
Eco57I	CTGAAG	1 cut(s)	84
Eco81I	CCTNAGG	1 cut(s)	326
EcoRII	CCWGG	2 cut(s)	12, 276
EcoT14I	CCWWGG	1 cut(s)	7
EcoT22I	ATGCAT	1 cut(s)	183
ErhI	CCWWGG	1 cut(s)	7
FaeI	CATG	4 cut(s)	50, 130, 144, 376
FatI	CATG	4 cut(s)	46, 126, 140, 372
HaeIII	GGCC	1 cut(s)	12
Hin1II	CATG	4 cut(s)	50, 130, 144, 376
HinfI	GANTC	2 cut(s)	214, 319
HphI	GGTGA	1 cut(s)	37
Hpy166II	GTNNAC	1 cut(s)	28
Hpy188I	TCNGA	1 cut(s)	222
Hpy188III	TCNNGA	3 cut(s)	157, 209, 316
Hpy8I	GTNNAC	1 cut(s)	28
Hpy99I	CGWCG	1 cut(s)	222
HpyCH4III	ACNGT	1 cut(s)	343
HpyCH4IV	ACGT	1 cut(s)	282
HpyCH4V	TGCA	4 cut(s)	140, 181, 336, 390
HpyF10VI	GCNNNNNNNGC	2 cut(s)	52, 178
HpyF3I	CTNAG	2 cut(s)	261, 326
HpySE526I	ACGT	1 cut(s)	282
Hsp92II	CATG	4 cut(s)	50, 130, 144, 376
LmnI	GCTCC	1 cut(s)	268
LpnPI	CCDG	7 cut(s)	26, 54, 194, 263, 290, 301, 313
MaeII	ACGT	1 cut(s)	282
MaeIII	GTNAC	1 cut(s)	363
MluCI	AATT	2 cut(s)	118, 385
MlyI	GAGTC	2 cut(s)	208, 313
MmeI	TCCRAC	2 cut(s)	200, 246
MnlI	CCTC	3 cut(s)	15, 228, 335
Mph1103I	ATGCAT	1 cut(s)	183
MseI	TTAA	1 cut(s)	289
MslI	CAYNNNNRTG	1 cut(s)	341
MspCI	CTTAAG	1 cut(s)	288
MspR9I	CCNGG	2 cut(s)	14, 278
Mva1269I	GAATGC	2 cut(s)	8, 181
MvaI	CCWGG	2 cut(s)	14, 278
MwoI	GCNNNNNNNGC	2 cut(s)	52, 178
NlaIII	CATG	4 cut(s)	50, 130, 144, 376
NmeAIII	GCCGAG	1 cut(s)	258
NsiI	ATGCAT	1 cut(s)	183
OliI	CACNNNNGTG	1 cut(s)	341
PctI	GAATGC	2 cut(s)	8, 181
PfoI	TCCNGGA	1 cut(s)	276
PleI	GAGTC	2 cut(s)	208, 313
PpsI	GAGTC	2 cut(s)	208, 313
Psp6I	CCWGG	2 cut(s)	12, 276
PspGI	CCWGG	2 cut(s)	12, 276
RseI	CAYNNNNRTG	1 cut(s)	341
SaqAI	TTAA	1 cut(s)	289
SchI	GAGTC	2 cut(s)	208, 313
ScrFI	CCNGG	2 cut(s)	14, 278
SetI	ASST	8 cut(s)	68, 206, 239, 249, 262, 273, 285, 332
SfcI	CTRYAG	1 cut(s)	339
SmiMI	CAYNNNNRTG	1 cut(s)	341
SmlI	CTYRAG	1 cut(s)	288
SmoI	CTYRAG	1 cut(s)	288
Sse9I	AATT	2 cut(s)	118, 385
StyD4I	CCNGG	2 cut(s)	12, 276
StyI	CCWWGG	1 cut(s)	7
TaaI	ACNGT	1 cut(s)	343
TaiI	ACGT	1 cut(s)	285
TasI	AATT	2 cut(s)	118, 385
Tru1I	TTAA	1 cut(s)	289
Tru9I	TTAA	1 cut(s)	289
TscAI	CASTG	1 cut(s)	348
TspRI	CASTG	1 cut(s)	348
Vha464I	CTTAAG	1 cut(s)	288
Zsp2I	ATGCAT	1 cut(s)	183

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.