Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0001200

Physical Location & Seq

Genomic Coordinates Forward (+)

59301949 .. 59302290

Gene Structure 342 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ21023

Sequence Viewer

CDS Protein Promoter (2k)

Length: 207 bp

ATGATATCTGTTGTTTTCCCTATTCAACAGGTTTGGGCTTCAAAGTGGAATGAAAGAGCTTTTATTAGTCATAAGAAAGCTAAACTAGACCATGAGAACATATGCATGGCTGTAAATTCAAGAAATCATCTGTGCCGATTATGCCTTTGTTATTCACACAAAAAATCCCCTTGTCAGGGAATACTGCAGAAATTTACAGAGAGATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009526 GO:0009536 GO:0009941 GO:0031967 GO:0031975 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF2934 PPDK_N

Protein Analysis

68

Amino Acids

8.0

Weight (kDa)

9.55

Isoelectric Point (pI)

53.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001200)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0129611 RchiOBHm_Chr3g0476471 RchiOBHm_Chr6g0270131 RchiOBHm_Chr7g0233921 RchiOBHm_Chr7g0233931 RchiOBHm_Chr7g0234461 RchiOBHm_Chr7g0234611 RchiOBHm_Chr7g0234621
rosa_laevigata	RLG00000001213 RLG00000001221 RLG00000001227 RLG00000021012 RLG00000023959
rosa_multiflora	Rmu_co8468527.1_g000001 Rmu_sc0000974.1_g000014 Rmu_sc0001528.1_g000001 Rmu_sc0003291.1_g000028 Rmu_sc0003321.1_g000002 Rmu_sc0004303.1_g000006 Rmu_sc0004864.1_g000021 Rmu_sc0008667.1_g000013 Rmu_sc0011456.1_g000004 Rmu_sc0023836.1_g000001
rosa_roxburghii	Rroxscaffold_1G00049680 Rroxscaffold_3G00226730 Rroxscaffold_3G00226790 Rroxscaffold_3G00226800 Rroxscaffold_4G00302360
rosa_rugosa	Rorug01G0119600 Rorug01G0119700 Rorug01G0119800 Rorug02G0400100 Rorug07G0163100 Rorug07G0163100 Rorug07G0163200.1 Rorug07G0284900 Rorug07G0285500 RorugPtG0000400.1 RorugPtG0000500 RorugPtG0000600
rosa_samantha	Rh1DG123700 Rh2AG327500 Rh2DG356100 Rh2DG519500 Rh3DG370800 Rh5AG164500 Rh5CG516500 Rh7AG439900 Rh7BG412700 Rh7BG412900 Rh7BG413000 Rh7CG461700
rosa_wichuraiana	Rw2G026740 Rw7G036220 Rw7G036280 Rw7G036420 Rw7G036560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	115, 191
AfiI	CCNNNNNNNGG	2 cut(s)	175, 176
AgsI	TTSAA	3 cut(s)	26, 42, 120
AluBI	AGCT	2 cut(s)	59, 80
AluI	AGCT	2 cut(s)	59, 80
ApoI	RAATTY	2 cut(s)	115, 191
BfaI	CTAG	1 cut(s)	86
BfmI	CTRYAG	1 cut(s)	185
Bsc4I	CCNNNNNNNGG	2 cut(s)	175, 176
BseLI	CCNNNNNNNGG	2 cut(s)	175, 176
BslI	CCNNNNNNNGG	2 cut(s)	175, 176
BspMAI	CTGCAG	1 cut(s)	189
BstMWI	GCNNNNNNNGC	1 cut(s)	141
BstSFI	CTRYAG	1 cut(s)	185
CviAII	CATG	2 cut(s)	92, 106
CviJI	RGCY	4 cut(s)	38, 59, 80, 110
CviKI_1	RGCY	4 cut(s)	38, 59, 80, 110
Eco32I	GATATC	1 cut(s)	6
EcoRV	GATATC	1 cut(s)	6
EcoT22I	ATGCAT	1 cut(s)	107
FaeI	CATG	2 cut(s)	95, 109
FaiI	YATR	6 cut(s)	72, 93, 101, 103, 107, 142
FatI	CATG	2 cut(s)	91, 105
FauNDI	CATATG	1 cut(s)	101
FspBI	CTAG	1 cut(s)	86
Hin1II	CATG	2 cut(s)	95, 109
Hpy188III	TCNNGA	1 cut(s)	120
HpyCH4V	TGCA	2 cut(s)	105, 187
HpyF10VI	GCNNNNNNNGC	1 cut(s)	141
Hsp92II	CATG	2 cut(s)	95, 109
LpnPI	CCDG	2 cut(s)	14, 161
MaeI	CTAG	1 cut(s)	86
MluCI	AATT	2 cut(s)	115, 191
Mph1103I	ATGCAT	1 cut(s)	107
MslI	CAYNNNNRTG	1 cut(s)	104
MwoI	GCNNNNNNNGC	1 cut(s)	141
NdeI	CATATG	1 cut(s)	101
NlaIII	CATG	2 cut(s)	95, 109
NsiI	ATGCAT	1 cut(s)	107
PstI	CTGCAG	1 cut(s)	189
RseI	CAYNNNNRTG	1 cut(s)	104
SetI	ASST	3 cut(s)	33, 61, 82
SfcI	CTRYAG	1 cut(s)	185
SgeI	CNNG	7 cut(s)	41, 98, 104, 118, 132, 183, 188
SmiMI	CAYNNNNRTG	1 cut(s)	104
Sse9I	AATT	2 cut(s)	115, 191
SspMI	CTAG	1 cut(s)	86
TasI	AATT	2 cut(s)	115, 191
TspDTI	ATGAA	1 cut(s)	66
XapI	RAATTY	2 cut(s)	115, 191
XspI	CTAG	1 cut(s)	86
Zsp2I	ATGCAT	1 cut(s)	107

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.