Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008667.1

Orthogroup ID

OG0001200

Physical Location & Seq

Genomic Coordinates Reverse (-)

41720 .. 43028

Gene Structure 1309 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008667.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

atgcaaagttcaggaatgccttggcctggtgatgagggtgaacaacgatgggaacaagcatggttggctataaaaaaggttgtcaaaggtcttggagaaaccttagttagagcttatcctggacgtgccttaagttttattagcaagaaaaatgctctggactctcctcaggtgttaggttaccctagcaaaccggttggcctctttatcagacggtccataatcttccgatccgattccaatggtgaagatcttgaaggttatgccggtgcaggcctttatgacaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000272 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005975 GO:0005976 GO:0005982 GO:0005983 GO:0006073 GO:0006793 GO:0006796 GO:0006950 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009251 GO:0009266 GO:0009409 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009605 GO:0009607 GO:0009608 GO:0009610 GO:0009620 GO:0009628 GO:0009631 GO:0009941 GO:0009987 GO:0016052 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016781 GO:0031967 GO:0031975 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044042 GO:0044237 GO:0044238 GO:0044247 GO:0044248 GO:0044260 GO:0044262 GO:0044264 GO:0044275 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0050521 GO:0050896 GO:0051704 GO:0051707 GO:0071704 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPDK_N

Protein Analysis

96

Amino Acids

10.62

Weight (kDa)

9.05

Isoelectric Point (pI)

57.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001200)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0129611 RchiOBHm_Chr3g0476471 RchiOBHm_Chr6g0270131 RchiOBHm_Chr7g0233921 RchiOBHm_Chr7g0233931 RchiOBHm_Chr7g0234461 RchiOBHm_Chr7g0234611 RchiOBHm_Chr7g0234621
rosa_laevigata	RLG00000001213 RLG00000001221 RLG00000001227 RLG00000021012 RLG00000023959
rosa_multiflora	Rmu_co8468527.1_g000001 Rmu_sc0000974.1_g000014 Rmu_sc0001528.1_g000001 Rmu_sc0003291.1_g000028 Rmu_sc0003321.1_g000002 Rmu_sc0004303.1_g000006 Rmu_sc0004864.1_g000021 Rmu_sc0008667.1_g000013 Rmu_sc0011456.1_g000004 Rmu_sc0023836.1_g000001
rosa_roxburghii	Rroxscaffold_1G00049680 Rroxscaffold_3G00226730 Rroxscaffold_3G00226790 Rroxscaffold_3G00226800 Rroxscaffold_4G00302360
rosa_rugosa	Rorug01G0119600 Rorug01G0119700 Rorug01G0119800 Rorug02G0400100 Rorug07G0163100 Rorug07G0163100 Rorug07G0163200.1 Rorug07G0284900 Rorug07G0285500 RorugPtG0000400.1 RorugPtG0000500 RorugPtG0000600
rosa_samantha	Rh1DG123700 Rh2AG327500 Rh2DG356100 Rh2DG519500 Rh3DG370800 Rh5AG164500 Rh5CG516500 Rh7AG439900 Rh7BG412700 Rh7BG412900 Rh7BG413000 Rh7CG461700
rosa_wichuraiana	Rw2G026740 Rw7G036220 Rw7G036280 Rw7G036420 Rw7G036560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	225
AfiI	CCNNNNNNNGG	1 cut(s)	26
AflII	CTTAAG	1 cut(s)	130
AgeI	ACCGGT	1 cut(s)	193
AgsI	TTSAA	1 cut(s)	257
AjiI	CACGTC	1 cut(s)	125
AjnI	CCWGG	2 cut(s)	25, 118
AluBI	AGCT	1 cut(s)	113
AluI	AGCT	1 cut(s)	113
AlwI	GGATC	1 cut(s)	225
AoxI	GGCC	3 cut(s)	23, 199, 274
AsiGI	ACCGGT	1 cut(s)	193
AspS9I	GGNCC	1 cut(s)	216
AsuHPI	GGTGA	3 cut(s)	41, 50, 257
AvaII	GGWCC	1 cut(s)	216
AxyI	CCTNAGG	1 cut(s)	168
BccI	CCATC	1 cut(s)	42
BciT130I	CCWGG	2 cut(s)	27, 120
BfaI	CTAG	1 cut(s)	186
BfrI	CTTAAG	1 cut(s)	130
BglII	AGATCT	1 cut(s)	250
Bme1390I	CCNGG	2 cut(s)	27, 120
Bme18I	GGWCC	1 cut(s)	216
BmgBI	CACGTC	1 cut(s)	125
BmgT120I	GGNCC	1 cut(s)	216
BmrFI	CCNGG	2 cut(s)	27, 120
BsaJI	CCNNGG	1 cut(s)	20
BsaWI	WCCGGW	1 cut(s)	193
Bsc4I	CCNNNNNNNGG	1 cut(s)	26
Bse118I	RCCGGY	2 cut(s)	193, 266
Bse21I	CCTNAGG	1 cut(s)	168
BseBI	CCWGG	2 cut(s)	27, 120
BseDI	CCNNGG	1 cut(s)	20
BseLI	CCNNNNNNNGG	1 cut(s)	26
BseMII	CTCAG	1 cut(s)	182
BseRI	GAGGAG	1 cut(s)	156
BsgI	GTGCAG	1 cut(s)	291
BshFI	GGCC	3 cut(s)	25, 201, 276
BshTI	ACCGGT	1 cut(s)	193
BsiSI	CCGG	2 cut(s)	194, 267
BslI	CCNNNNNNNGG	1 cut(s)	26
BsmI	GAATGC	1 cut(s)	21
BsnI	GGCC	3 cut(s)	25, 201, 276
Bsp143I	GATC	2 cut(s)	230, 250
BspANI	GGCC	3 cut(s)	25, 201, 276
BspCNI	CTCAG	1 cut(s)	181
BspPI	GGATC	1 cut(s)	225
BspTI	CTTAAG	1 cut(s)	130
BsrFI	RCCGGY	2 cut(s)	193, 266
BssAI	RCCGGY	2 cut(s)	193, 266
BssECI	CCNNGG	1 cut(s)	20
BssMI	GATC	2 cut(s)	230, 250
BssT1I	CCWWGG	1 cut(s)	20
Bst2UI	CCWGG	2 cut(s)	27, 120
Bst4CI	ACNGT	1 cut(s)	216
BstAFI	CTTAAG	1 cut(s)	130
BstC8I	GCNNGC	1 cut(s)	274
BstDEI	CTNAG	2 cut(s)	103, 168
BstEII	GGTNACC	1 cut(s)	179
BstKTI	GATC	2 cut(s)	233, 253
BstMBI	GATC	2 cut(s)	230, 250
BstMWI	GCNNNNNNNGC	1 cut(s)	65
BstNI	CCWGG	2 cut(s)	27, 120
BstPI	GGTNACC	1 cut(s)	179
BstSCI	CCNGG	2 cut(s)	25, 118
BstX2I	RGATCY	1 cut(s)	250
BstYI	RGATCY	1 cut(s)	250
Bsu36I	CCTNAGG	1 cut(s)	168
BsuRI	GGCC	3 cut(s)	25, 201, 276
BtrI	CACGTC	1 cut(s)	125
Cac8I	GCNNGC	1 cut(s)	274
Cfr10I	RCCGGY	2 cut(s)	193, 266
Cfr13I	GGNCC	1 cut(s)	216
CspAI	ACCGGT	1 cut(s)	193
CviAII	CATG	1 cut(s)	60
CviJI	RGCY	5 cut(s)	25, 68, 113, 201, 276
CviKI_1	RGCY	5 cut(s)	25, 68, 113, 201, 276
DdeI	CTNAG	2 cut(s)	103, 168
DpnI	GATC	2 cut(s)	232, 252
DpnII	GATC	2 cut(s)	230, 250
Eco130I	CCWWGG	1 cut(s)	20
Eco147I	AGGCCT	1 cut(s)	276
Eco47I	GGWCC	1 cut(s)	216
Eco81I	CCTNAGG	1 cut(s)	168
Eco91I	GGTNACC	1 cut(s)	179
EcoO65I	GGTNACC	1 cut(s)	179
EcoRII	CCWGG	2 cut(s)	25, 118
EcoT14I	CCWWGG	1 cut(s)	20
ErhI	CCWWGG	1 cut(s)	20
FaeI	CATG	1 cut(s)	63
FaiI	YATR	5 cut(s)	61, 71, 221, 264, 282
FatI	CATG	1 cut(s)	59
FspBI	CTAG	1 cut(s)	186
HaeIII	GGCC	3 cut(s)	25, 201, 276
HapII	CCGG	2 cut(s)	194, 267
Hin1II	CATG	1 cut(s)	63
HinfI	GANTC	2 cut(s)	161, 236
HpaII	CCGG	2 cut(s)	194, 267
HphI	GGTGA	3 cut(s)	41, 50, 257
Hpy166II	GTNNAC	1 cut(s)	41
Hpy188I	TCNGA	3 cut(s)	212, 230, 235
Hpy188III	TCNNGA	3 cut(s)	12, 158, 254
Hpy8I	GTNNAC	1 cut(s)	41
HpyAV	CCTTC	1 cut(s)	251
HpyCH4III	ACNGT	1 cut(s)	216
HpyCH4IV	ACGT	1 cut(s)	124
HpyCH4V	TGCA	2 cut(s)	4, 272
HpyF10VI	GCNNNNNNNGC	1 cut(s)	65
HpyF3I	CTNAG	2 cut(s)	103, 168
HpySE526I	ACGT	1 cut(s)	124
Hsp92II	CATG	1 cut(s)	63
Kzo9I	GATC	2 cut(s)	230, 250
MaeI	CTAG	1 cut(s)	186
MaeII	ACGT	1 cut(s)	124
MaeIII	GTNAC	1 cut(s)	179
MalI	GATC	2 cut(s)	232, 252
MboI	GATC	2 cut(s)	230, 250
MboII	GAAGA	2 cut(s)	217, 260
MflI	RGATCY	1 cut(s)	250
MlyI	GAGTC	1 cut(s)	155
MnlI	CCTC	3 cut(s)	28, 177, 212
MseI	TTAA	1 cut(s)	131
MspCI	CTTAAG	1 cut(s)	130
MspI	CCGG	2 cut(s)	194, 267
MspR9I	CCNGG	2 cut(s)	27, 120
Mva1269I	GAATGC	1 cut(s)	21
MvaI	CCWGG	2 cut(s)	27, 120
MwoI	GCNNNNNNNGC	1 cut(s)	65
NdeII	GATC	2 cut(s)	230, 250
NlaIII	CATG	1 cut(s)	63
PceI	AGGCCT	1 cut(s)	276
PctI	GAATGC	1 cut(s)	21
PfeI	GAWTC	1 cut(s)	236
PfoI	TCCNGGA	1 cut(s)	118
PinAI	ACCGGT	1 cut(s)	193
PleI	GAGTC	1 cut(s)	155
PpsI	GAGTC	1 cut(s)	155
Psp6I	CCWGG	2 cut(s)	25, 118
PspEI	GGTNACC	1 cut(s)	179
PspGI	CCWGG	2 cut(s)	25, 118
PspPI	GGNCC	1 cut(s)	216
PsuI	RGATCY	1 cut(s)	250
SaqAI	TTAA	1 cut(s)	131
Sau3AI	GATC	2 cut(s)	230, 250
Sau96I	GGNCC	1 cut(s)	216
SchI	GAGTC	1 cut(s)	155
ScrFI	CCNGG	2 cut(s)	27, 120
SetI	ASST	9 cut(s)	81, 91, 104, 115, 127, 174, 181, 262, 290
SinI	GGWCC	1 cut(s)	216
SmlI	CTYRAG	1 cut(s)	130
SmoI	CTYRAG	1 cut(s)	130
SseBI	AGGCCT	1 cut(s)	276
SspMI	CTAG	1 cut(s)	186
StuI	AGGCCT	1 cut(s)	276
StyD4I	CCNGG	2 cut(s)	25, 118
StyI	CCWWGG	1 cut(s)	20
TaaI	ACNGT	1 cut(s)	216
TaiI	ACGT	1 cut(s)	127
TfiI	GAWTC	1 cut(s)	236
Tru1I	TTAA	1 cut(s)	131
Tru9I	TTAA	1 cut(s)	131
Vha464I	CTTAAG	1 cut(s)	130
VpaK11BI	GGWCC	1 cut(s)	216
XspI	CTAG	1 cut(s)	186

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.