RchiOBHm_Chr7g0234621

water dikinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
59302616 .. 59303388
773 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21024

Sequence Viewer

Length: 153 bp
ATGATCTTTGATAAGGGCTTCCAAGTCTCACTCTTCTCAAGAATTGCAGACGTGGGGAAGATATTAGAAGGCCTTTATGGTTGTCCTCAGGACATTGAAGGTGTGGTAAAAGATGGATTGATATACGTAGTTCAGTCAAGGCCACAAATCTAG

Protein Analysis

50

Amino Acids

5.54

Weight (kDa)

4.93

Isoelectric Point (pI)

46.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPDK_N PF01326 13 - 49 8.2e-06 Pyruvate phosphate dikinase, AMP/ATP-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 98
AjiI CACGTC 1 cut(s) 52
Alw26I GTCTC 1 cut(s) 31
AoxI GGCC 2 cut(s) 70, 140
AxyI CCTNAGG 1 cut(s) 87
BccI CCATC 1 cut(s) 107
BcoDI GTCTC 1 cut(s) 31
BfaI CTAG 1 cut(s) 151
BmgBI CACGTC 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 22
BsaAI YACGTR 1 cut(s) 127
Bse21I CCTNAGG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 101
BshFI GGCC 2 cut(s) 72, 142
BsmAI GTCTC 1 cut(s) 31
BsnI GGCC 2 cut(s) 72, 142
Bsp143I GATC 1 cut(s) 3
BspANI GGCC 2 cut(s) 72, 142
BspCNI CTCAG 1 cut(s) 100
BssMI GATC 1 cut(s) 3
Bst6I CTCTTC 1 cut(s) 38
BstBAI YACGTR 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 87
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 31
BstMBI GATC 1 cut(s) 3
BstSNI TACGTA 1 cut(s) 127
Bsu36I CCTNAGG 1 cut(s) 87
BsuRI GGCC 2 cut(s) 72, 142
BtrI CACGTC 1 cut(s) 52
CviJI RGCY 3 cut(s) 18, 72, 142
CviKI_1 RGCY 3 cut(s) 18, 72, 142
DdeI CTNAG 1 cut(s) 87
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
Eco105I TACGTA 1 cut(s) 127
Eco147I AGGCCT 1 cut(s) 72
Eco81I CCTNAGG 1 cut(s) 87
FaiI YATR 2 cut(s) 78, 124
FspBI CTAG 1 cut(s) 151
HaeIII GGCC 2 cut(s) 72, 142
Hpy188III TCNNGA 2 cut(s) 39, 89
HpyAV CCTTC 2 cut(s) 62, 92
HpyCH4IV ACGT 2 cut(s) 51, 126
HpyCH4V TGCA 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 87
HpySE526I ACGT 2 cut(s) 51, 126
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 1 cut(s) 74
MaeI CTAG 1 cut(s) 151
MaeII ACGT 2 cut(s) 51, 126
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 2 cut(s) 25, 70
MluCI AATT 1 cut(s) 42
MnlI CCTC 1 cut(s) 96
NdeII GATC 1 cut(s) 3
PceI AGGCCT 1 cut(s) 72
Ppu21I YACGTR 1 cut(s) 127
Sau3AI GATC 1 cut(s) 3
SetI ASST 3 cut(s) 54, 103, 129
SgeI CNNG 4 cut(s) 35, 51, 64, 101
SmlI CTYRAG 1 cut(s) 37
SmoI CTYRAG 1 cut(s) 37
SnaBI TACGTA 1 cut(s) 127
Sse9I AATT 1 cut(s) 42
SseBI AGGCCT 1 cut(s) 72
SspMI CTAG 1 cut(s) 151
StuI AGGCCT 1 cut(s) 72
TaiI ACGT 2 cut(s) 54, 129
TasI AATT 1 cut(s) 42
XspI CTAG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.